1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Verizon [17]
3 years ago
14

What would happen if replication of chromosomes did not occur before cytokinesis?

Biology
1 answer:
Volgvan3 years ago
5 0
The cell process would be most likely to abort, because the chromosomes failed to make it replication, therefore, the chromosomes probably would not make it to cytokinesis, or the two cells would have an uneven number of chromosomes.
You might be interested in
A key component in the formation of organic compounds, such as nucleic acids and ATP Most abundant gas in the atmosphere; plants
Veronika [31]

Answer:

it nitro(N) accounts for 70% of the earth's atmosphere

Explanation:

5 0
3 years ago
Read 2 more answers
A food source that contains all the essential amino acids is called a(n):
asambeis [7]
Complete protein, also known as whole protein is a type of protein or source of protein which contains all nine essential amino acids in appropriate amounts. Foods with complete protein includes animal meat, eggs, grains, whey protein and legumes.
7 0
3 years ago
Read 2 more answers
_____ includes crude comments or sexual jokes and behaviors that convey hostility toward a particular gender.
Sati [7]

Answer:

Gender Harrassment

Explanation:

This could also be called sexism.

7 0
3 years ago
Which organism is a herbivore? A. spider B. bacterium C. grass D. grasshopper
kumpel [21]
The answer is D. grasshopper
5 0
3 years ago
Read 2 more answers
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Other questions:
  • What fat are broken down to enter the respiratory system?
    8·1 answer
  • Dosterone...
    12·1 answer
  • Which statement best describes Earth’s outer layer underneath the surface in the image?
    11·1 answer
  • Which best describes the relationship between population size, carrying capacity, and limiting factors?
    10·2 answers
  • While cleaning a saltwater aquarium, students placed a family of fiddler crabs from the saltwater aquarium into a container of d
    5·2 answers
  • Factory → air → plants → Animals
    6·2 answers
  • What patterns is most likely to indicate a food borne illness?
    6·1 answer
  • A particular protein (Vac8) found in yeast has this N-terminal sequence, Met-Gly-Ser-Ser-Cys.... The corresponding DNA sequence
    15·1 answer
  • Elements 1 and 3 are used to make the most common substance in the body. What are these elements?
    12·1 answer
  • How are transgenic animals different from knockout animals?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!