1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nirvana33 [79]
3 years ago
7

Two heterozygous purple-flowering pea plants are crossed. If purple is dominant over white, what are the expected phenotypic res

ults? A). 100% purple B). 75% purple, 25% white C). 50% purple, 50% white D). 25% purple, 75% white

Biology
2 answers:
Lera25 [3.4K]3 years ago
8 0

Answer:

The correct answer would be B). 75% purple, 25% white.

In Mendelian genetics, the cross between two heterozygous parents results in the production of offspring with a genotypic ratio of 1:2:1. They have a phenotypic ratio of 3 (dominant) : 1 (recessive).

The same can be explained with the help of Punnett square. Let us assume P (dominant) and p (recessive) be the alleles of the gene responsible for the color of flowers in a plant.

The genotype of parents would be Pp.

The cross would produce offspring with three possible genotype combinations which are PP, Pp, and pp in 1:2:1.

Plant with PP and Pp genotype will produce purple flowers and plant with pp genotype will produce white flowers.

Thus, 75% (3 out of 4) would purple-flowered plants and 25% (1 out of 4) would be a white-flowered plant.

horrorfan [7]3 years ago
7 0
Pp><Pp
= PP (purple homozygous)
2Pp (purple heterozygous)
pp (white)

purple= 3/4 . 100%
=75%
white=1/4 . 100%
= 25%

answer: b
You might be interested in
Viruses reproduce by ___? 1) Asexual 2) fission 3) mitosis 4) none of the above
Katen [24]

hi there

your answer is :they  asexual

The structure of viruses allows them to succeed in their main mission—reproduction. the Ly tic Cycle Once attached to a host cell,after a virus injects its nucleic acid into the cell. The nucleic acid takes over the normal operation of the host cell and produces multiple copies of the virus's protein coat and nucleic acid the host will get sick and yes, might die from it .

A large percentage of microorganisms, the prokaryotes (those without a nucleus) reproduce asexually.

I hope this helped u out

have a great afternoon

FaithRawlins14

6 0
3 years ago
This green pigment found in plants traps energy from the Sun for photosynthesis.
34kurt
Chlorophyll is the answer I am 100% sure
6 0
3 years ago
Read 2 more answers
Which statements describe the Peary Land ecosystem? Select all that apply
fgiga [73]

Answer:

1 and 2

Explanation:

hope this helps a lot:3

4 0
2 years ago
Need help asp have no idea what this answer is . A group of zebras would be A Community B Ecosystem C Population Which biome wou
djverab [1.8K]

The first questions answer is a community.

The second questions answer is a desert.

Hope this helps.

8 0
3 years ago
Read 2 more answers
What does the cell copy during DNA replication
White raven [17]
The cell copies its DNA during DNA replication.
6 0
3 years ago
Other questions:
  • How many layers of phospholipids does the cell membrane have?
    9·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Please help me!!!!! Asap!!!
    15·1 answer
  • Can plants produce oxygen in the dark?
    6·2 answers
  • Go to bad jk hey wyd
    10·2 answers
  • 2. A living disease carrier is called a: *
    12·1 answer
  • Sarah’s classes studying soils. They are learning about soil texture. Sarah hold a handful of damp soil in her hand. She rubs so
    10·2 answers
  • How many groups of reactions is/are there in photosynthesis ?
    15·1 answer
  • Select the best answer that describes how lionfish are impacting biodiversity in Florida. O Lionfish are consuming large quantit
    12·1 answer
  • Antimicrobials that are effective against a wide variety of microbial types are termed _______.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!