1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sedaia [141]
3 years ago
9

Cells have organs just like us true or false

Biology
2 answers:
Alex73 [517]3 years ago
8 0

Answer:

true or so google says lol

Tpy6a [65]3 years ago
4 0
Some what true. Cells have organ like tissues within the cell membrane.
You might be interested in
In a chemical bond between two or more atoms, what creates the bond?
antoniya [11.8K]
Electron pairs , because the atoms become stable by gaining the electron pairs
8 0
3 years ago
Read 2 more answers
Ocean tides of Earth are strongly influenced by the Moon. During which lunar phases are ocean tides lowest on Earth?
Nonamiya [84]

Answer:

Full moon and new moon

Explanation:

3 0
3 years ago
Which of these describes lichens and mosses that first colonize a previously barren area?
faust18 [17]

The answer is; pioneer species

These pioneer species have adaptations such as minute roots that enable them to grow on rocks, with little nutrients, and need no soil. This is why they are able to colonize new barren land. They are able to break down rocks to soil and give an opportunity for higher plants to later colonize the environment after time.  


6 0
4 years ago
How does an adult hydra produce a new hydra?
Pani-rosa [81]

<u><em>C. By growing a bud</em></u>

<u><em>I took the test</em></u>

8 0
4 years ago
A point mutation is shown in the mutated DNA sequence below. Will this mutation affect
SVETLANKA909090 [29]

My 2 cents below, I tried to think through the other ones:

A. Yes, because an amino acid change has occurred.  

(A gene mutation occurred, not an amino acid change)

B. Yes, because all mutations change the resulting protein.

(Sounds correct. Gene -> mRNA -> protein)

C. No, because the amino acid sequence has not been changed.

(The gene mutation means the amino acid sequence <em>has</em> changed)

D. No, because mutations in the DNA do not affect the mRNA sequence.

(They do so)

3 0
3 years ago
Other questions:
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • In addition, as organisms grow and change, they need new cells to make more skin tissue, bone tissue, muscle tissue. These new c
    9·1 answer
  • Question 19 (2 points)
    8·2 answers
  • Cells that are similar in structure and function are usually joined together by what
    12·1 answer
  • If you perceive a stimulus and then later perceive the same stimulus again, you are likely to perceive the stimulus more quickly
    13·1 answer
  • What does not require the breakdown of ATP?
    6·1 answer
  • Identify the process used to form the covalent peptide bonds that join amino acids into a polypeptide.
    7·1 answer
  • I need help on question 16 for quiz 3.2
    7·2 answers
  • 12 After many investigations, Dr. Grossman, a geologist, developed an idea about
    6·1 answer
  • I need someone to do a essay for me the information about the essay is in the picture
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!