1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ulleksa [173]
3 years ago
13

Proteins...

Biology
1 answer:
irinina [24]3 years ago
3 0
I would say the answer is c or d
You might be interested in
Imagine a cell has a higher concentration of Na inside than outside. Imagine the membrane voltage on this cell is negative (Vm &
matrenka [14]

Answer and explanation:

If a cell has a higher concentration of sodium inside than the sodium concentration that there is outside of it, there will be a chemical gradient that will direct the sodium to the outside, to equate the concentrations between the inside of the cell and the outside of the cell.

The membrane voltage on cells depends on the conductance of each ion. The more conductant an ion is, the more likely is that it will go through the membrane from the inside to the outside or vice versa. This conductivity relies on the number of active protein channels specific to that ion that can be found in the membrane. If the membrane voltage is negative when the cell is at resting potential, it means that the most conductant ion is one whose equilibrium potential is negative as well. Sodium's equilibrium potential is positive, which suggests that there is another ion inside this cell that is more conductant and whose equilibrium potential is negative - probably potassium.

Given that the membrane voltage is negative, which means that there are more positively charged particles outside than inside, the sodium will most likely flow from the outside to the inside - the electrical force on sodium will be from the outside to the inside.

The determining direction of the sodium will be given by the electrochemical gradient and will depend on the magnitude of the chemical gradient and the electrical one.

6 0
3 years ago
Use the points of the cell theory to say why humans and bacteria are similar.
Genrish500 [490]

Answer:

Humans have many cells. Bacteria have one cell. The second point is that cells are the basic unit of structure and function in humans and bacteria. The third point is that new human and new bacterial cells come only from other human and bacterial cells.

Explanation:

8 0
2 years ago
What are the steps in protein synthesis?
Nonamiya [84]
The central dogma of molecule genetics is that information flows from DNA to RNA and through this to the protein.
7 0
4 years ago
Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
topjm [15]

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

3 0
3 years ago
How does the parsympatheitc nervous system and sympathetic nervous system effect the heart?
forsale [732]
Heart rate is controlled by the two branches of the autonomic (involuntary) nervous system. The sympathetic nervous system (SNS) and the parasympathetic nervous system (PNS). The sympathetic nervous system (SNS) releases the hormones (catecholamines - epinephrine and norepinephrine) to accelerate the heart rate. The parasympathetic nervous system (PNS) releases the hormone acetylcholine to slow the heart rate. Such factors as stress, caffeine, and excitement may temporarily accelerate your heart rate, while meditating or taking slow, deep breaths may help to slow your heart rate.
4 0
3 years ago
Other questions:
  • What is the correct term for a release of an ovum in the female reproductive system?
    8·2 answers
  • Giving one or more explanations for an observed phenomenon is a(n)
    12·2 answers
  • The defense mechanisms where one imposes one's own unacceptable impulses or wishes onto another person is_______________.
    5·1 answer
  • Why do scientists classify organisms? A. to have a systematic way of categorizing newly discovered organisms B. to determine rel
    8·2 answers
  • Study the diagram of a cell.
    6·1 answer
  • PLEASE HELP!!!!
    6·2 answers
  • In some places, one or more rock layers are missing in a sequence. For example, suppose you
    10·1 answer
  • Amylose is a form of starch made up of α glucose monomers that are bound by 1-4 linkages. How would the molecule be affected if
    13·1 answer
  • Which of the natural resources will be most affected as people try to meet the growing demand for food
    13·1 answer
  • Help Plzzzzz Thxxxxx
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!