1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Effectus [21]
4 years ago
14

Congress established the _____ in 1969 to help with the air pollution problem.

Biology
2 answers:
dimulka [17.4K]4 years ago
7 0
The Environmental Protection Agency (EPA)

qaws [65]4 years ago
3 0
Congress established the EPA (Environmental Protection Agency) in 1969 to help with the air pollution problem.
You might be interested in
What is the main purpose of photosynthesis?
aivan3 [116]
Ehsbbdbcnfndjndndnfbdbdhdh
4 0
3 years ago
It would not have occurred to her that an action which is ineffectual thereby becomes meaningless. what action is winston recall
earnstyle [38]
Based on the statement mentioned above,  Winston is alluding to his mom. His mom's sentiments had a place with an alternate time. Dedication, cherish, honorability was altogether intended to her despite the fact that they won't influence the result of a given circumstance.
7 0
3 years ago
What characteristics of the plant make it a living thing?
scoundrel [369]
Plants are living things because they are made of living cells and exchange gases with the air around.
8 0
3 years ago
Please someone help me I don’t know which is which
Natali5045456 [20]

Answer:

a pili.                               f flagellae

b  nucleoid                    g chromosome

c plasma membrane    h ribosomes

d cell wall

e capsule

Explanation:

3 0
3 years ago
In some single-celled protozoans living in fresh water,
jolli1 [7]

Paramecium needs contractile vacuole due to its different environment from other protozoan that lives in salt water.

<h3>Need of contractile vacuole for paramecium</h3>

In salt water, the solute concentration outside the cell is more than inside the cell so the water flows out of the cell down the concentration gradient. Therefore contractile vacuoles are not required for expelling water for most protozoan living in salt water.

While on the other hand, paramecium lives in fresh water so contractile vacuole is required for removing excess water so we can conclude that paramecium needs contractile vacuole due to its different environment from other protozoan that lives in salt water.

Learn more about contractile vacuole here: brainly.com/question/15648413

7 0
2 years ago
Other questions:
  • What term refers to allowing foods to remain for too long at a temperature that allows the growth of germs?
    9·2 answers
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • The flagella and pili are similar in that they are both composed of
    10·1 answer
  • What is the main function of the lymphatic system
    5·1 answer
  • What is unique about the dna of a prokaryote?
    13·1 answer
  • Which of the following statements correctly explains the fact that all seven of the pea plant traits studied by Mendel obeyed th
    7·1 answer
  • What bone is located at the centre of the rib cage?
    15·1 answer
  • Which part of the nervous system is outside the brain and spinal cord?<br><br> Blank nervous system
    12·2 answers
  • During which step would a mutation lead to the formation of an alterd gene
    5·1 answer
  • 1.) How will the rising of a hot air balloon in cold air be different then if it rises in warm air?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!