Some reactions that break down glucose occur in different parts of the cell than others, why?

Biology

1 answer:

AysviL [449]3 years ago

6 0

Answer - Some organelles Specialized in parts of cell need glucose(Sugar) which is then broken down into protein called Glycoproteins. That is used to make Lysosomes or into Vesicles from Golgi Apparatus for Transportation.

Reasoning - Yep Glucose is important and Different parts of the cell don't need it. Simple.

You might be interested in

The part of the experiment in which the experimental factor has been removed is referred to as the ?

Tju [1.3M]

The part of the experiment in which the experimental factor has been removed is referred to as <span>the independent variable. </span>The dependent variable<span> is the element which is being measured in an experiment or evaluated in a mathematical equation.</span>

4 0

3 years ago

A set of flashcards on prokaryotes is being sorted into piles. which definition should not be placed in the pile for high-gc gra

sergey [27]

A. they have a higher proportion of adenine–thymine than guanine–cytosine base pairs.

The option A represents the complete opposite of "high-gc gram-positive bacteria". High GC content means that this bacteria have more guanine ans more cytosine than the other base pairs- adenine–thymine. This means all the other options are correct.

4 0

2 years ago

How do living cells use the instructions in their DNA to perform tasks?

Ksenya-84 [330]

Answer:

DNA contains the instructions to help the cell survive. They help the cell produce protein in the stages of protein synthesis.

7 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

Describe a DNA mutation and how it can affect an offspring.

Greeley [361]

A DNA mutation is a permanent alteration in the DNA sequence that makes up a gene, such that the sequence differs from what is found in most people. Mutations range in size; they can affect anywhere from a single DNA building block (base pair) to a large segment of a chromosome that includes multiple genes. DNA mutations can affect an offspring can result in abnormal protein products. Mutations can also introduce new alleles into a population of organisms and increase the population's genetic variation.

5 0

3 years ago

Read 2 more answers