1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zielflug [23.3K]
3 years ago
15

Four real life examples of scientific investigation

Biology
1 answer:
irina1246 [14]3 years ago
5 0
Real life examples of scientific investigations include:
1. Investigation on the causes of Ebola and production of vaccine for the disease.
2. Scientific research on cancer and production of cancer drugs.
3. Scientific investigation on the causes of tuberculosis and production of tuberculosis drugs.
4.  Production of Geckskin, a new supper adhesive.
You might be interested in
Using the drop-down menus, identify the
Harman [31]

Answer: label A - dna

label B - cell membrane

label C - ribosomes

label D - cytoplasm

Explanation:

7 0
3 years ago
Is the PO4 group present in amine compounds?
Bumek [7]
It is maybe or maybe it isn't
3 0
3 years ago
After arousal by a sensory stimulus, consciousness can be maintained by positive feedback, because of activity in the
KIM [24]

Answer:

This question lacks options, options are:

A) cerebral cortex.

B) basal nuclei.

C) sensory pathways.

D) motor pathways.

E) All of the answers are correct.

The correct answer is E.

Explanation:

The cerebral cortex processes and filters its information before passing the most relevant aspects to other regions of the brain. Some of these brain regions, in turn, send information back to the cortex. These loops, known as 'feedback systems', are considered essential for the functioning of cortical networks and their adaptation to new sensory information. Neural circuits must first assess the importance of incoming sensory information and then refine how it is processed in the future. Positive feedback, triggered with the purpose of amplifying the response to the initial stimulus, can be compared to a chain reaction or a vicious circle. Few are the functions regulated by this mechanism; rather it is triggered in pathological situations. It is the system by means of which the organism very rarely regulates any of the bodily functions under normal conditions, making the initial stimulus to be maintained and even increased. This type of mechanism is predominantly present in pathological situations: Its constitutive elements are: stimulus, receptor, afferent pathway, integrating center, efferent pathway, effector and response. The response does not have the ability to satisfy the initial stimulus.

6 0
3 years ago
What type of white blood cell it is not produced in the bone marrow?
motikmotik

Explanation:

All white blood cells are produced and derived from multipotent cells in the bone marrow known as hematopoietic stem cells. Leukocytes are found throughout the body, including the blood and lymphatic system.

6 0
3 years ago
Read 2 more answers
What do earth scientists study?
Kruka [31]
The correct answer is oceans
6 0
3 years ago
Read 2 more answers
Other questions:
  • Which process is responsible for continually wearing away the Earth's surface? deposition folding erosion faulting
    14·1 answer
  • Are two organisms more closely related if they are in the same kindom or phylum?
    15·1 answer
  • Discuss two ways that radiometric dating can be used to establish the age of a fossil.
    13·1 answer
  • Compared to an adult of appropriate weight, an underweight adult will have what issues?
    5·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Why is a complex food web better than a simple food chain for the survival of the community?
    13·1 answer
  • Birds are called glorified reptiles.why?​
    7·1 answer
  • In certain fish, blue scales (B) and red scales (R) are codominant. Cross a blue
    8·1 answer
  • Who is the man known to be responsible for the five basic rules of genetics?
    6·1 answer
  • The Brahman cattle have good resistance to high temperature, but its meat is poor and tough to eat. The English shorthorn cattle
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!