Answer:
White wool
Explanation:
The genotypes of every offspring will be Ww, making white dominant over black.
Answer:
How are the nucleus and a vesicle similar and different in structure and function? Both are membrane-bound compartments that store and separate certain materials. The nucleus is an almost permanent structure protected by a double membrane bilayer, whereas a vesicle is a temporary organelle.
Answer:nuclear reactor, solar panel
Explanation:there are several papers about going to moon and making a working habitat system a moon base, but we need power and i am confuse with which is best source for generating power for moon mission.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
Trace fossils provide us with indirect evidence of life in the past, such as the footprints, tracks, burrows, borings, and feces left behind by animals, rather than the preserved remains of the body of the actual animal itself.
