1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marysya [2.9K]
3 years ago
6

Which of these types of weathering requires the presence of water

Biology
1 answer:
Masja [62]3 years ago
6 0

Answer:

Hydrolysis

Explanation:

Hydrolysis is the breakdown of molecules as a result of coming in contact with water

You might be interested in
Please help me
Marta_Voda [28]

Answer:

what do you need help with?

Explanation:

7 0
3 years ago
1. Describe some of the important observations that Darwin made, both while he was traveling on the expedition of The Beagle and
lions [1.4K]

In Galapagos Charles Darwin Discovered a large amount of birds and reptiles that had developed a sense of isolation from the main land.

Explanation:

8 0
3 years ago
How long can a healthy ecosystem remain stable.​
Lesechka [4]

Answer:

Each component is in balance with the other components. As long as the components are in balance, the ecosystem can remain stable and healthy. Ecosystems may remain stable for many years if the different components are balanced.

4 0
3 years ago
Read 2 more answers
How do leaves help with cellular reputation ?
charle [14.2K]
Photosynthesis is the process by which plants use light energy to convert carbon dioxide and water into sugars...Respiration occurs when glucose combines with oxygen to produce useable cellular energy. This energy is used to fuel growth and all of the normal functions.
6 0
3 years ago
I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
Anarel [89]
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
4 0
3 years ago
Other questions:
  • What is a radical?
    10·1 answer
  • How is the size of the pupil regulated
    14·2 answers
  • Which statements accurately describe conduction and convection? CHECK ALL THAT APPLY 1. Only conduction needs matter to transfer
    8·2 answers
  • How are bacteria, a rose, and an elephant alike?
    14·2 answers
  • Many Japanese people consume a diet rich in seaweed, including the edible red alga Porphyra, which is used for preparing sushi.
    15·1 answer
  • A mouse are 380 calories worth of cherries. A fox catches it . How many calories does the fox obtain?
    6·1 answer
  • Kendra wants to use similes to describe the reflection and absorption of waves. Which pair of similes best fit?
    6·2 answers
  • Question 2 (1 point)
    11·1 answer
  • Can someone tell me the answer
    6·1 answer
  • Which experiment has the most reliable results?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!