1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mario62 [17]
3 years ago
14

Complete the sentence. The Coriolis effect causes surface ocean currents to _____.

Biology
1 answer:
Marianna [84]3 years ago
4 0
Here is the complete sentence with the correct answer; The Coriolis effect causes surface ocean current to sink toward the ocean floor, then rise again to the surface. The correct answer is D. 
You might be interested in
If blood is in short supply, which blood type would be the most beneficial to have on hand if someone needed a blood transfusion
fredd [130]
O blood is called the UNIVERSAL BLOOD DONOR as they can give to any other blood type.
5 0
3 years ago
Read 2 more answers
Which statements best describe the first stage of cellular respiration?
Alexeev081 [22]

Answer:

The stage happens in cutoplasm

Explanation:

In this step, enzymes split a molecule of glucose into two molecules of pyruvate, which releases energy that is transferred to ATP. The organelle called a mitochondrion is the site of the other two stages of cellular respiration.

7 0
3 years ago
Read 2 more answers
Now can you predict nucleotide quantities in a hypothetical scenario with more than four different types of nucleotides? An alie
den301095 [7]

Answer:

16% is G

12% is T

12%is A

22% is X

Explanation:

Given that each nucleotide is complimentary to another nucleotide, there cannot be more of one than the other. For example, C bonds to G, so there cannot be more C than G, because there would be nothing for it to bond to.

So if there is approximately 16% of the genome composed of C, that would mean that approximately 16% is composed of G (for it to bond to).

The same logic can be used to determine the amount of nucleotide X is present. If Y binds to X, and approximately 22% is composed of nucleotide Y, then the same percentage can be given to nucleotide X, and say the amount of X is 22%.

Now all of the nucleotides have to add up to 100%, so:

A + T + G + C + X + Y = 100%

A + T + (16%) + (16%) + (22%) + (22%) = 100%

A + T = 24%

Given that A binds to T, they must be equal to each other, hence we can say that the concentration of A, equals the concentration of T.

Therefore, the concentration of A is 12%, and the concentration of T is also 12%.

4 0
2 years ago
Which is not a reason the high specific heat of water is important on Earth?
svetoff [14.1K]

Answer:

I think it is A

6 0
3 years ago
The following are uses conversation gambits except​
jeka94
I don’t know to be honest what are the choices
4 0
2 years ago
Other questions:
  • In large doses, niacin has been shown to lower blood levels of __________.
    5·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • A tree grows and increases its mass explain why it is not a violation of the law of conservation of mass
    5·1 answer
  • Which of these examples demonstrates metabolism?
    15·2 answers
  • What tools would a scientist use to investigate a sinkhole
    15·1 answer
  • Why do cells need glucose?
    7·2 answers
  • Which is most likely to promote the growth of animals?
    14·1 answer
  • If an organism's gametes contain 25 chromosomes, how many chromosomes will their somatic (body cells) contain?
    9·1 answer
  • What makes amino acids unique from one another?
    14·1 answer
  • TRUE/FALSE. if one parent has all blue eyes in the family and the other parent has brown eyes can the baby have green eyes
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!