1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PolarNik [594]
3 years ago
8

Which of the following has bacteriochlorophylls and uses alcohols for carbon?

Biology
1 answer:
Afina-wow [57]3 years ago
7 0

That's easy it would be A) <u>Chemoautotroph</u>

You might be interested in
Is it true that pimples come due to late night sleep also ?​
nasty-shy [4]
No I believe that’s False
7 0
3 years ago
Read 2 more answers
Wendy is a paleontologist and finds a fossil of a bony fish buried in the sediment on the coast. After observing and recording s
antiseptic1488 [7]
The answer is B <span>that bony fish evolved before land plants </span>


6 0
3 years ago
Read 2 more answers
Listeriosis is of particular concern for pregnant women because pregnant women are more likely than other population groups to g
Igoryamba

Answer:

The correct answer is ''All of the choices are correct.''

Explanation:

Pregnant women are a risk group for listeriosis, the disease caused by the Listeria monocytogenes bacteria found in contaminated food. This organism can cross the placenta and affect the fetus. Due to the decrease in cellular immunity, pregnant women are part of the population at risk and are 17-20 times more likely to develop listeriosis after the consumption of contaminated food and it usually occurs from the third trimester and appears as a disease mild with not very high fever, joint and muscle pain. Listeriosis can cause miscarriages during the first three months of pregnancy. As the third trimester is reached, the mother is at greater risk. It presents a 40-50% fetal or neonatal mortality. In the first or second trimester it produces septic abortions and intrauterine fetal death, in the third trimester she produces chorioamnionitis and premature labor. In 1/3 cases it can occur asymptomatically in the fetus / neonate. In newborns, listeriosis can cause blood infections and meningitis.

6 0
2 years ago
Identify two examples of environmental factors that may impact salivary peroxidase activity. Describe how each of the environmen
charle [14.2K]

Answer:

Examples of environmental factors that may alter salivary peroxidase include periodontitis, oral hygiene, presence of heavy metal ions, bacteria (e.g., <em>Streptococcus gordonii</em>), anaerobic conditions, temperature, pH, etc.

Explanation:

Peroxidase is an enzyme found in all aerobic cells that act to convert toxic hydrogen peroxide (H2O2) into dioxygen (O2) and water (H2O). This enzyme plays an important non-specific defensive role against proliferating micro-organisms that cause periodontal diseases such as periodontitis, which is a serious inflammatory disease affecting the tissues around the teeth. The most common environmental factors influencing the development of periodontitis include oral hygiene, smoking and age. In this regard, it has recently been shown that there is a positive correlation between salivary peroxidase activity and periodontal health, especially in non-smoker individuals. In consequence, it is expected that smoker individuals are more prone to suffer periodontal diseases by reduction of the salivary peroxidase levels.

7 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
Other questions:
  • during physical exertion, animals begin to respire heavily. What is the purpose of the heavy breathing?
    15·1 answer
  • A population of snail darters is drastically reduced by the introduction of a large predator fish into an isolated stream. the p
    9·1 answer
  • Why are crickets primary consumers
    13·1 answer
  • Binary fission is the most common form of reproduction in _____.
    13·2 answers
  • Hereditary monarchies, whereby the crown passes down through a single family, are examples of:
    15·1 answer
  • Which of the following is a characteristic shared by most animals
    5·1 answer
  • All castes have the same dharma at all stages of life. <br> a. True <br> b. False
    13·2 answers
  • Which part of a DNA molecule is responsible for the direct coding of specific traits in an organism?
    11·1 answer
  • Many bacteria and fungi are important in the environment because they
    15·2 answers
  • Which of the following is a major category of animal tissue?A. EpitheliumB. LymphC. Blood serumD. Heart
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!