No I believe that’s False
The answer is B <span>that bony fish evolved before land plants </span>
Answer:
The correct answer is ''All of the choices are correct.''
Explanation:
Pregnant women are a risk group for listeriosis, the disease caused by the Listeria monocytogenes bacteria found in contaminated food. This organism can cross the placenta and affect the fetus. Due to the decrease in cellular immunity, pregnant women are part of the population at risk and are 17-20 times more likely to develop listeriosis after the consumption of contaminated food and it usually occurs from the third trimester and appears as a disease mild with not very high fever, joint and muscle pain. Listeriosis can cause miscarriages during the first three months of pregnancy. As the third trimester is reached, the mother is at greater risk. It presents a 40-50% fetal or neonatal mortality. In the first or second trimester it produces septic abortions and intrauterine fetal death, in the third trimester she produces chorioamnionitis and premature labor. In 1/3 cases it can occur asymptomatically in the fetus / neonate. In newborns, listeriosis can cause blood infections and meningitis.
Answer:
Examples of environmental factors that may alter salivary peroxidase include periodontitis, oral hygiene, presence of heavy metal ions, bacteria (e.g., <em>Streptococcus gordonii</em>), anaerobic conditions, temperature, pH, etc.
Explanation:
Peroxidase is an enzyme found in all aerobic cells that act to convert toxic hydrogen peroxide (H2O2) into dioxygen (O2) and water (H2O). This enzyme plays an important non-specific defensive role against proliferating micro-organisms that cause periodontal diseases such as periodontitis, which is a serious inflammatory disease affecting the tissues around the teeth. The most common environmental factors influencing the development of periodontitis include oral hygiene, smoking and age. In this regard, it has recently been shown that there is a positive correlation between salivary peroxidase activity and periodontal health, especially in non-smoker individuals. In consequence, it is expected that smoker individuals are more prone to suffer periodontal diseases by reduction of the salivary peroxidase levels.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T