1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
skelet666 [1.2K]
3 years ago
14

A mutation occurs in an original DNA template that changes the DNA, changes the RNA, but does not change the protein sequence. W

hat kind of mutation is this. and what would be the consequence of this original change?
Biology
1 answer:
jonny [76]3 years ago
5 0

Answer:

<h2>The changes that do not affect the function of a protein are called silent mutations.</h2>

Explanation:

As given here as a mutation occurs in an original DNA template that changes the DNA, by transcription this mutation passes into RNA and changes the RNA, but it does not change the protein sequence, it means that this mutation could be silent mutation.

Silent mutation is the mutation which cause the change of a base in that, after the mutation the codon codes for the same amino acid, or the amino acid which do no cause any change in the protein, hence these changes do not affect the function of a protein.

You might be interested in
Else has been hallucinations and suffering from delusions. in addition to schizophrenia, she could also be suffering from:
nadezda [96]

If a person is suffering from schizophrenia, other manifestations that Else can be suffering of aside delusions and hallucinations is that she can experience a lack of motivation when doing her activities, confused thinking and she will likely hear voices that does not even exist.

5 0
3 years ago
What does it mean to describe a scientist as sketptical?
dexar [7]
To describe a scientist as skeptical, they question existing ideas and a new hypothesis. skepticism is a valuable quality because it shows that scientists is good and open minded.

i hope this helps...
6 0
3 years ago
Outline the biochemical pathways which enables cells to produce energy using glucose and oxygen
Eduardwww [97]

Cellular respiration is a metabolic pathway that breaks down glucose and produces ATP.

<h3>What is respiration?</h3>

Respiration is the process in which cells use oxygen to break down sugar in order to obtain energy. Glycolysis, pyruvate oxidation, the citric acid or Krebs cycle, and oxidative phosphorylation are the stages of cellular respiration.

So we can conclude that Cellular respiration is a metabolic pathway that breaks down glucose and produces ATP.

Learn more about cell here: brainly.com/question/13123319

8 0
2 years ago
How are species introduced to new ecosystems
Sergio039 [100]
Speciation I believe..
5 0
3 years ago
CAN YOU HELLLLLLLLP PPPPPPPPPPLLLLLLLLLLZ AND THANK UUUUUPP.........................
Nadusha1986 [10]
A, An ancestor of whales had legs. Hope i helped! :D
6 0
3 years ago
Other questions:
  • What famous scientist was born today, november 7th?
    5·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • The glomerular filtrate contains a lower concentration of _____ than does blood plasma.
    14·1 answer
  • Is there a relationship between crystal size and intrusive rocks
    11·1 answer
  • A patient with muscular dystrophy starts to receive stem cells that generate muscle tissue. Which is the best prediction of what
    14·2 answers
  • TRUE OR FALSE? Mineral ores provide us with all the raw materials to make virtually everything, from toothpaste to CD players an
    8·2 answers
  • Please help it’s urgent!!!!
    5·1 answer
  • Solar and Wind power are good for the environment because…
    5·2 answers
  • Which pair are the correct base pairs in DNA?
    15·1 answer
  • Quartz is an important mineral in mafic rocks like basalt and gabbro. <br> a. true <br> b. false
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!