1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ratelena [41]
3 years ago
14

What are the harmful effects of pizza?

Biology
1 answer:
Black_prince [1.1K]3 years ago
4 0
You could get bad acne.
You might be interested in
Can someone help me !!
STatiana [176]

Answer:

do it ur self stop being lazy dang

Explanation:

6 0
3 years ago
Most sedimentary rocks form:
amm1812

Answer:

The answer is option A: layers

3 0
3 years ago
1. Primary producers include plants, algae, and cyanobacteria. The amount of biomass produced
slava [35]

Answer:

Explanation:

Tropical Rain forest -> Temperate Forest -> Taiga -> Tundra

4 0
3 years ago
Auxins _____.
arlik [135]
I believe auxins are used for fast growth in of the stem(shoot), retention of fruits, it induces flowering
3 0
4 years ago
Read 2 more answers
What family does the mushroom come from
Karo-lina-s [1.5K]
They come from the agaric family
7 0
3 years ago
Read 2 more answers
Other questions:
  • Scientists use specific levels of organization in order to analyze the biosphere. The Everglades are a large area of subtropical
    10·2 answers
  • How does overdependence on a few staple foods increase the risk of famine? staple foods have fewer calories than other foods, wh
    9·1 answer
  • The solution outside of a cell is a hypotonic sugar-water solution. Which would typically be the result of osmosis so that a cel
    14·1 answer
  • If a cell with 36 chromosomes undergoes mitosis, how many chromosomes will each of the two new cells have?
    7·2 answers
  • paragraph explaining how energy flows through energy pyramid trophinc level producer primary consumer desompsor sun secondary co
    11·1 answer
  • PLEASE ANSWER WILL GIVE 75 POINTS
    11·1 answer
  • Why are dichotomous keys used?
    8·2 answers
  • How are cellular respiration and photosynthesis related, in terms of energy?
    11·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Which of the following are fossil fuels? (choose all that apply.)
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!