1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yanalaym [24]
3 years ago
8

What kinds of animals usually live in the areas often represented by the blue map?

Biology
2 answers:
Vlad [161]3 years ago
7 0
Hey there,
The animals which live in the area represented by the blue maps are marine animals.

Hope this helps :))

<em>~Top♥</em>
Nimfa-mama [501]3 years ago
4 0
Most often it's sea creatures
You might be interested in
Increasing the thermal energy of water enough will cause it to ___________
Rufina [12.5K]
Evaporate. 

I hope this helped you!
4 0
3 years ago
____________________________________ and ________________________________ factors can affect an
Setler79 [48]

Answer:

This question makes no sense

Explanation:

8 0
3 years ago
Climatic regions are classified according to temperature and __________.
ioda
Precipitation.....................
7 0
3 years ago
Read 2 more answers
Upon examining a sample consisting of 100 cells, you find the following distribution of cell phases. If you know that the cell c
Firdavs [7]

Answer:

the time that cell spend in prophase is 30 minutes

Explanation:

The computation is shown below:

= Number of cell ÷ sample

= 25 ÷ 100

= 1 ÷ 4

Now it takes two hours

So,

= 1 ÷ 4 × 2 hours

= 0.5

This 0.5 represent the 30 minutes

Hence, the time that cell spend in prophase is 30 minutes

6 0
3 years ago
In the epinephrine pathway, an inhibitor of phosphodiesterase activity would have which of the following effects? A. block the a
Artemon [7]

Answer: C). prolong the effect of epinephrine by maintaining elevated cAMP levels in the cytoplasm

Explanation: In the epinephrine pathway, binding of epinephrine to its receptor triggers a conformational change in the receptor and the interaction of the receptor with its associated Gs protein. This interaction causes the replacement of GDP bound to Gs protein with GTP thus activating the Gs protein. The activation of the Gs protein causes the alpha subunit of the Gs protein to dissociate and move to adenylyl cyclase, another membrane protein in the pathway. The association of the alpha subunit of the Gs protein with adenylyl cyclase activates adenylyl cyclase which in turn catalyzes the synthesis of cyclic AMP (cAMP) a second messenger. cAMP is quickly degraded to 5'-AMP by an enzyme phosphodiesterase. Inhibition of the activity of phosphodiesterase will increase the half life and the cytoplasmic level of cAMP thus potentiating the action of epinephrine.

5 0
4 years ago
Other questions:
  • You succeed in inducing a mutation that causes a loss of function in the fungal component of soredia. you excitedly inform your
    11·1 answer
  • When the base of a glacier melts and refreeze it will likely pick up some rocks this process is called ?
    9·2 answers
  • In three to five sentences, compare systems for digestion in an amoeba to those in a mouse. What specializations exist in the bo
    6·1 answer
  • Why have so many bacteria now able to resist antibiotics
    7·1 answer
  • 4. How do ocean currents influence climate? Give an example of such an ocean current.
    7·1 answer
  • Mariam's ophthalmologist prescribes a prostaglandin analog for her glaucoma and explains that prostaglandin inhibitors act by __
    6·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Biologist use what to create a cladogeam and why
    9·1 answer
  • 2. 2hat is the difference between an organ and a organ system?
    14·1 answer
  • 7. Explain how magnetic potential energy can be transformed into kinetic energy. ​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!