1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KiRa [710]
3 years ago
9

How does climate affect the rate of weathering

Biology
2 answers:
slava [35]3 years ago
7 0
Rainfall and temperature can affect the rate in which rocks weather. High temperatures and greater rainfall increase the rate of chemical weathering. 2. Rocks in tropical regions exposed to abundant rainfall and hot temperatures weather much faster than similar rocks residing in cold, dry regions.



Thank me rn
lara31 [8.8K]3 years ago
5 0
Rainfall and temperature can affect the rate<span> in which rocks weather. High temperatures and greater rainfall increase the </span>rate<span> of chemical </span><span>weathering.</span>
You might be interested in
A 60 year-old man has long managed his type 1 diabetes effectively with a combination of vigilant blood sugar monitoring, subcut
ivanzaharov [21]

The question is incomplete as it lacks the multiple options. The multiple option are as follows;

Careful monitoring for level of consciousness and resolution of hypoglycemia .

IV infusion of 50% dextrose and water solution .

Administration of subcutaneous glucagon

Administration of 15 to 20 g of glucose in a concentrated carbohydrate source

Answer:

Administration of 15 to 20 g of glucose in a concentrated carbohydrate source.

Explanation:

The insulin and glucagon hormone maintains the blood glucose level in the humans. In case of Type I diabetes a little amount or no amount of insulin is made by the pancreas.

The wife of a man has caused insulin error that creates hypoglycemic condition means the individual has low blood glucose level. The intake of carbohydrates can increase his blood glucose level. The wife should give 15 to 20 g of glucose to make the conditions normal.

Thus, the answer is option (4).

7 0
3 years ago
Plz help asap???!!!!30pts
attashe74 [19]

Answer:

What do you need to be answered

Explanation:

6 0
3 years ago
Read 2 more answers
NEED HELP!!
BabaBlast [244]

Answer

A: stalagmites

B. Sinkholes

D. stalactites

Just took the edge2020 test and these are right

4 0
3 years ago
Read 2 more answers
The change in electrical potential that occurs when an impulse passes through a nerve cell
Nadusha1986 [10]

Answer:

The answer to this definition is: ACTION POTENTIAL

Explanation:

Action potential is a phenomenon in nervous system used to describe a change in electrical current that occurs when an impulse passes through a neuron or nerve cell. Action potential is induced when sodium (Na+) ions move from the extracellular environment into the intracellular environment.

Impulse travels across the axon of a neuron and thereby causes a difference in the electric potential i.e. - mv to + mv. This process, according to this question, whereby a change in electrical potential occurs due to the passage of an impulse through a nerve cell is termed ACTION POTENTIAL.

4 0
3 years ago
Do lavenders undergo photosynthesis? (Yes or no)
pogonyaev

Answer:

yes

Explanation:

The leaves of purple plants still have chlorophyll which looks green to us. So since they have chlorophyll, they can carry out photosynthesis.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Idk how this is biology but , its on my work. i need help​
    8·1 answer
  • Why did the plant cell plasmolyze when immersed in a hypertonic solution?
    15·1 answer
  • How does the addition or removal of heat change the state of an object?
    5·1 answer
  • Differences in density of ocean water is important because it
    6·1 answer
  • What role do membranes play in prokaryotic cells? In eukaryotic cells
    10·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • David shows delayed intellectual development and has flattened facial features. The doctors explain that this genetic disorder i
    9·2 answers
  • At the time this article was written (2011) how many and what types of genomes have been sequenced? Give a general summary.
    12·1 answer
  • Hemoglobin is the oxygen carrying compound found in human blood. It is found to contain 0.3335% iron by mass. It is already know
    13·1 answer
  • Why is it important to scientists for a hypothesis to be testable? How would the experiment differ if it were not?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!