1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bezzdna [24]
3 years ago
14

What occurs during the S phase of interphase

Biology
2 answers:
Sindrei [870]3 years ago
6 0
Cell Replication happens in S phase
Alex17521 [72]3 years ago
6 0

The correct answer A. cell growth and activity.


You might be interested in
Work in the scientific sense is: energy x force force x distance energy x distance
Sav [38]
Work is force x distance.
3 0
3 years ago
How many elements did Mendeleev’s original periodic table have?
Artist 52 [7]

63 is your answer hope this helps

8 0
3 years ago
Read 2 more answers
An animal is ________ if it is able to maintain its temperature through bodily processes.
Stella [2.4K]

An animal is endothermic if it is able to maintain its temperature through bodily processes.

4 0
3 years ago
Which statement accurately describes how genetic information is transferred during meiosis?
gulaghasi [49]
Search I’m safari there is the answer I think
5 0
3 years ago
There are both short term and long term complications of diabetes. Describe an example below for each category.
mariarad [96]
A long term complication of diabetes is damage to smaller and larger blood vessels. As a result of this, it can cause damage to the heart, brain, eyes and legs- this is often why people have to have part of their leg amputated due to diabetes. A short term complication of diabetes is Hypoglycaemia, Ketoacidosis, and these are a result of the blood glucose becoming too low. This is usually when someone has to inject themselves with insulin, or have something sweet that is able to increase their blood sugar levels. Hope this helps :)
8 0
3 years ago
Other questions:
  • Am I correct??????????
    7·2 answers
  • How does human activity affect the environment
    14·1 answer
  • Which of the following statements is correct with respect to the photosynthetic pathway of grass or a cactus?
    13·1 answer
  • 2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
    14·1 answer
  • The typical size of a bacterium is <br> A. 1 nm<br> B. 10 nm<br> C. 1000 nm<br> D. 1 km
    6·1 answer
  • Bill wants to determine his blood type, so he takes a few drops of blood from a puncture wound in his finger and mixes it with v
    9·1 answer
  • Which was Charles Darwin's contribution to the study of biology?
    8·1 answer
  • HELPP
    10·1 answer
  • ALOT OF POINTS MARKING POEPLE AS BRAINLIST
    14·2 answers
  • Do the physical characteristics given identify characteristics of the Sun, Earth, or Moon?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!