1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tatiana [17]
3 years ago
14

I need help with this please:

Biology
1 answer:
WARRIOR [948]3 years ago
5 0
Schizophrenia is <span>a long-term mental disorder of a type involving a breakdown in the relation between thought, emotion, and behavior, leading to faulty perception, inappropriate actions and feelings, withdrawal from reality and personal relationships into fantasy and delusion, and a sense of mental fragmentation. 

Having schizophrenia can effect your daily functioning in many ways like;
</span><span>Change in friends or social isolation, Difficulty at school or job, Sleep problems, Irritability, Difficulty telling reality from fantasy and <span>An increase in unusual thoughts, perceptions and suspicions or paranoia. </span><span>Odd manner of thinking and speaking

</span></span>Harmful alcohol<span> and other drug use, particularly cannabis and amphetamine use, may </span>trigger psychosis<span> in people who are vulnerable to developing </span>schizophrenia<span>. While substance use </span>does<span> not </span>cause schizophrenia<span>, it is strongly related to relapse.</span>
You might be interested in
Cell 4 and cell 7 will not be able to synthesize a major biological molecule. What molecule is this?
IrinaVladis [17]

Answer:

15. Cell 4 and Cell 7 will not be able to synthesize a major biological molecule. What molecule is this? Protein.

6 0
2 years ago
A person who is infected by a parasitic worm is likely to have an increased level of eosinophils.
Serggg [28]
The correct answer is True.

I hope this helps you and have a great day!! :)
5 0
3 years ago
What is the major function of the endomembrane system?
Svetllana [295]

Answer:

B. transporting substances in a cell

Explanation:

Endomembrane system is basically a system or organelles and membranes in eukaryotic cells, which is involved in packaging, modifying and transporting the proteins and lipids across the cell.

Many organelles and membranes play role in this system like lysosomes, endoplasmic reticulum, Golgi bodies and nuclear membrane.

Note: Chloroplasts, Mitochondria and peroxisomes are not part of endomembrane system.

You can see figure depicting endomembrane system for better understanding.


8 0
3 years ago
Hiivv tvvvgvgh hhhju vhjugghyvk b hhbh
Rus_ich [418]
Ndjdjdjfndbdhdjdjeisosospkcvn fbeieidkdjcvnjfdididifjck
6 0
3 years ago
four plants sitting in the window are beginning to lose their leaves, im thinking that if i move them to a sunnier window, they
noname [10]

Answer:

Hypothesis

Explanation:

Since you are thinking it/guessing it with the knowledge you already have I think it’s hypothesis.

This is the definition of hypothesis if it helps: a supposition or proposed explanation made on the basis of limited evidence as a starting point for further investigation.

7 0
3 years ago
Other questions:
  • A diagram that indicates the sequence of the evolution of important body plan features is a
    14·2 answers
  • The thermosphere is the hottest layer in the atmosphere because
    15·1 answer
  • One common fertility treatment for women is to take medications such as follicle-stimulating and luteinizing hormones to stimula
    13·2 answers
  • Which is the final event that occurs when a star is forming?
    14·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Science help please!
    12·1 answer
  • Cell Structure and Function
    14·1 answer
  • Can someone help me answer the last 2 question (#3 and 4). It asks about diabetes.
    13·1 answer
  • Which of the following is the most like the Biblical concept of grace:
    5·1 answer
  • Give 3 examples of adaptations observed in plant species
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!