1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blizzard [7]
4 years ago
6

If you were a doctor, and a lab technician told you that the results of a patient’s lab results were Gram-positive, what antibio

tics would you prescribe for the patient? Why?
Biology
1 answer:
xxTIMURxx [149]4 years ago
7 0
Any broad spectrum antibiotics can be used against bacterial infection, but beta-lactams like penicillin, amoxicillin and cephalosporin as well as macrolides  are more effective againts gram-positive bacteria.
You might be interested in
Which is NOT an example of a characteristic you might use to classify a bird?
11111nata11111 [884]

Answer:

year of its birth

8 0
3 years ago
Read 2 more answers
Answer the question please
MrRissso [65]

Answer: the answer is D

Explanation:

8 0
4 years ago
Read 2 more answers
Impaired and delayed healing in a person with diabetes is caused by chronic complications that include:
juin [17]
Chronic neuropathies
3 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
What is the name of thespecific organelle that is studded with<br> ribosomes in a eukaryoticcell?
Alik [6]

Answer:

The (rough) endoplasmic reticulum

Explanation:

The endoplasmic reticulum is a system of interconnected membranes that functions in the synthesis of several membrane-related proteins and lipids. There are two types of endoplasmic reticulum in the eukaryotic cell;

  • Smooth endoplasmic reticulum
  • Rough endoplasmic reticulum

The smooth endoplasmic reticulum is actually smooth because it has no ribosome attachment while the rough endoplasmic reticulum appears rough due to the attachment by ribosomes.

<em>Therefore, the name of the specific organelle that is studded with ribosomes in eukaryotic cell is endoplasmic reticulum.</em>

5 0
3 years ago
Other questions:
  • At point X, only the air that is in direct contact with the sand is heated. And at point Y, only subsurface sand that is in dire
    8·2 answers
  • An increase in venous return will _______.
    5·2 answers
  • Which of these words most closely matches the meaning of the word integrity in the sentence, "The ball of dough loses its struct
    8·1 answer
  • Which of the following statements is true?
    11·1 answer
  • Which of the following is not one of the four main types of tissues? basement epithelial connective muscle
    5·1 answer
  • What determines whether an allele is dominant recessive or codominant?
    10·1 answer
  • What do vacuoles and golgi bodies have in common?
    5·1 answer
  • Itś all in the link.
    14·1 answer
  • What is composes soil?
    13·1 answer
  • How the fruits and vegetables made available in the off seasons?​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!