1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naily [24]
4 years ago
12

Why do we have different time zones

Biology
2 answers:
swat324 years ago
6 0

As Earth rotates, different parts of Earth receive sunlight or darkness, giving us day and night. Since different parts of Earth enter and exit daylight at different times, we need different time zones. In the late 1800s, a group of scientists figured out a way to divide the world into different time zones.

Ket [755]4 years ago
6 0

Answer:Due to the earths rotation, different parts of the earth gets sunlight and some don't.

Explanation:

For example if the earth is rotated toward japan, japan will have sunlight and day, and the US for example will be night.

You might be interested in
Why are organisms classified? to determine why organisms reproduce to determine what characteristics future organisms will have
liq [111]

the correct answer is c

6 0
4 years ago
Read 2 more answers
Can you please help​
NeTakaya

Answer:

C

Explanation:

5 0
4 years ago
As a child, Liam was an outgoing boy who made friends easily. Today, he is the top salesman in his company and he is still outgo
d1i1m1o1n [39]

Answer:

The correct answer is - stability versus change.

Explanation:

Stability implies personality characteristics present during infancy endure throughout the entire life span. in Change theorists argue that personal personality alter by interactions with family , life experiences at various places and acculturation.

It is the development psychology phenomenon which deals with the traits that stay constant from the birth and the traits change throughout the life.

Thus, the correct is - stability versus change.

4 0
3 years ago
A partial food web is shown below which organisms in the food web or both primary and secondary consumers.
ValentinkaMS [17]

The correct answer is C. Coyotes

Coyotes are organisms in the food web which are both primary and secondary consumers.

7 0
3 years ago
Read 2 more answers
How does dehydration synthesis and hydrolysis relate to harnessing energy from food?
seraphim [82]
Dehydration synthesis is a process where formation of  a water molecule takes place while joining two molecules. Hydrolysis refers to a chemical reaction where breakdown of water molecule takes place. Thus, both the processes are opposite to each other but are related to each other while harnessing energy from the food. During dehydration synthesis the food molecule is formed with extraction of water from the food while during hydrolysis digestion of food particle takes place and water molecule is used in the process.
4 0
4 years ago
Other questions:
  • What role does an earthworm play in the food web? <br><br> PLEASE ANSWERR
    10·2 answers
  • Answer the following questions
    9·1 answer
  • Which organelles do eukaryotic cells have that prokaryotic cells do not have? Check all that are true.
    5·2 answers
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • Question 11
    12·2 answers
  • How does meiosis reduce the number on chromosomes contained in a cell?​
    7·1 answer
  • During DNA replication two identical DNA molecules are produced from one original molecule. Which statement below explains why t
    14·1 answer
  • 4. Show the cross between a ggBb and a GGBb. You'll have to set this one up yourself:
    9·1 answer
  • What percentage of the hydrosphere exists as salt water.
    8·1 answer
  • Question; testes are formed in the embryo after about ....... of pregnancy.
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!