During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Answer:
They were frugivores
Explanation:
Frugivores are animals that mainly eat raw fruits, vegetables, roots, seeds, shoots, etc. Frugivores need to eat diverse fruits and succulent fruit-like vegetables to fulfill their nutritional requirements, although they can supplement this diet with flowers, nectar, small insects, etc. Among their adaptations for fruit consumption, frugivore teeth are clearly distinct, having broad incisors to peel tough fruit rinds. Moreover, these animals generally have long small intestines to digest the fruit.
Why am I slightly threatened by this?
