1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lorasvet [3.4K]
4 years ago
12

Which portion of the brain tells you to move away from the oncoming car?

Biology
1 answer:
alukav5142 [94]4 years ago
6 0
The part that you sense with that's the hearing part
You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
The diagram below shows the positions of Earth, Sun, and moon during two types of tides.
Rina8888 [55]

The correct answer is C: the gravitational forces due to the sun and the moon cancel each other's effect.

4 0
3 years ago
Read 2 more answers
Which one of the following is an example of parasitism?
snow_lady [41]
D! I hope this helpssss
6 0
3 years ago
Two umbilical arteries leave the __________ of the fetus, enter the umbilical cord, and deliver blood to the placenta.
Aloiza [94]

Answer:

internal iliac arteries

Explanation:

6 0
4 years ago
Pls help asap best answer get=s brainlest
earnstyle [38]

Answer:

asexual reproduction through budding in the leaf

8 0
3 years ago
Other questions:
  • What role do ribosomes play in carrying out genetic information?
    11·1 answer
  • How does dna lead sientest to better classify organisims
    7·1 answer
  • I need some help with an environmental science question.
    13·1 answer
  • The restriction enzymes of bacteria protect the bacteria from successful attack by bacteriophages, whose genomes can be degraded
    8·1 answer
  • BIOLOGY! PLEASE HELP. WILL GIVE YOU BRAINLIEST
    14·1 answer
  • Which type of mountain is formed by vertical pressure? Which type is formed by the upward thrusts of Earth's crust?
    11·1 answer
  • A student observing a sample of cheek cells noticed that all of the cells were identical. Which statement below explains why the
    13·2 answers
  • What facilitates the diffusion of water across the cell membrane?
    12·2 answers
  • In normal cells, glucose is broken down aerobically and fed into the citric acid cycle to produce, among other things, lots of A
    15·1 answer
  • What kind of glands are the oil and sweat glands?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!