1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Masteriza [31]
3 years ago
7

How does dna lead sientest to better classify organisims

Biology
1 answer:
trasher [3.6K]3 years ago
4 0
By knowing the details on where and what about the organism, this helps with a lot of crime such as murder.
You might be interested in
Debbie was doing a science lab, and she was instructed to decide whether a piece of plastic would float or sink without actually
diamong [38]
Determine how heavy the piece of plastic is and if it's light than it is most likely to float
6 0
3 years ago
Read 2 more answers
In bryophytes, which of the following structures is like a root?
KiRa [710]
Just looked in my text book it says its the rhizoids
5 0
3 years ago
Read 2 more answers
To the
Travka [436]

Answer:

Maybe

Explanation:

nucleus;ribosome

because nucleus is cells control house and ribosome responsible for providing protein..

6 0
3 years ago
Microscopic plants called algae grow inside the top layer of sea ice in the Antarctic if enough sunlight reaches that layer of i
MrRa [10]

Answer:

The correct answer is: (A).

Explanation:

  • In the question, it is mentioned that the algae can grow under the conditions of "enough sunlight" and "enough nutrients".
  • Sunlight reaches the algae, by first falling on the surface made up of ice and snow and then refracting from there into the top layer of the ice where the algae grows.
  • However, the capability of both snow and ice to reflect sunlight is far more than that of refracting sunlight.
  • Therefore, the amount of light received by the algae is similar in absence or presence of the layer of snow on the top layer of ice.
  • However, on deposition of snow on the layer of the ice, the weight of the ice increases and it sinks below into sea water.
  • This allows more nutrient rich sea water to percolate into the ice and reach the algae.
  • The algae receive more nutrients from the sea water and hence is capable undergoing better metabolism and growth.
  • Hence, more algae are produced under such a situation.
5 0
3 years ago
Which statement best describes the relationship of photosynthesis and energy?
madam [21]

Answer:

The process of photosynthesis is energy-storing because the process converts light energy into chemical energy, which is stored in the bonds of glucose.

4 0
4 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • An ecosystem with a large number of species is said to have _____?
    8·1 answer
  • During high intensity exercise, lactate can be converted to which substance via the cori cycle?
    10·1 answer
  • ​which biological factor is not known to contribute to aggressive behavior?
    7·1 answer
  • keeping this in mind, and looking at the diagram, which of two animals are most likely to be closely related
    13·2 answers
  • How did the occurrences of the different traits change over the 30-year period? Use evidence from the graph to support your answ
    12·2 answers
  • How do you comment on brainly? It never lets me
    6·2 answers
  • In a Punnett Square, where are the parent alleles written _:
    11·2 answers
  • If I do sit-ups for 2 minutes, then my heart rate will speed up.
    6·1 answer
  • Simple tissues such as ________ are composed of a single type of cell. Group of answer choices parenchyma cork epidermis secreto
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!