1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vazorg [7]
3 years ago
13

Hinge joints are capable of only which two movements?

Biology
1 answer:
scoray [572]3 years ago
3 0
They are capable of slight rotation and side to side movement.
You might be interested in
What effect do the Aspergillus fungi have on the economy?
jarptica [38.1K]
It helps decompose dead waste such as animals and mice and birds and plants, it makes the earth cleaner.
7 0
3 years ago
Explain why lizards with brown tails are more likely to be eaten by snakes than the lizards with blue tails.
Alina [70]

Answer:

lizard tails with vivid blue reflectance evolved in communities with either weasel or snake predators, which can both detect blue wavelengths. However, lizard tail UV reflectance was much higher in populations with only snake predators, perhaps because snakes can detect UV, yet weasels cannot. Finally, a cryptic brown tail evolved on islands where birds are the primary lizard predator. Because birds have keen visual acuity, a brown, camouflaged tail may be more advantageous.

Explanation:

7 0
2 years ago
Media that contains extracts from plants animals or yeasts are
Nadusha1986 [10]
Complex. 
Hope this helps!
3 0
3 years ago
Read 2 more answers
Which of the following is part of the peripheral nervous system?
Stolb23 [73]
It is sensors :) i hope this helped you :)

8 0
3 years ago
Read 2 more answers
Somatoform disorders are characterized by excessive, physical complaints that are dramatic but do not fit any medical disease.
Julli [10]
True.....................
4 0
3 years ago
Other questions:
  • In which phylum do we first see tissue–level organization?
    13·1 answer
  • The energy pyramid below illustrates some feeding relationships in alpine meadows of Yellowstone National Park. Which statement
    7·1 answer
  • In grafting, the plant with the root system is called the , and the portion of the plant with the buds is called the .
    14·2 answers
  • "Ancient Greek Myths for Kids: The Story of King Midas and the Golden Touch - Ancient Greek Myth for Kids" https://greece.mrdonn
    11·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • HELP PLEASE ILL GIVE BRAINLIEST
    15·1 answer
  • Help me describe how these protists feed, move, and reproduce.
    9·1 answer
  • Which cloud is found ahead of a cold front, but behind the warm front?
    8·1 answer
  • 1. How do populations of organism's influence each other? Give an example.
    7·1 answer
  • A population of white-tailed deer inhabits a certain patch of forest in michigan. Which group of alleles can be considered the g
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!