1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bija089 [108]
3 years ago
12

If B represents the allele for black eyes (dominant) and b represents the allele for orange eyes (recessive), what would be the

phenotypic ratio of a cross between a heterozygous black-eyed MendAlien and an orange-eyed MendAlien?
Biology
1 answer:
siniylev [52]3 years ago
7 0
The ration for the phenotype would be 1:2
You might be interested in
Many different types of mutations can occur within the body. An individual experiences a mutation that changes a base
Georgia [21]

Answer:

The type of mutation responsible for changing a base in the mRNA strand, without changing the coding aminoacid or protein, is called a <u>silent</u> mutation.

Explanation:

In a silent mutation occurs the change of a nitrogenous base in one of the codons that encodes an aminoacid, without changing the aminoacid or altering the structure or function of the protein to be synthesized.

In this type of mutations the change of the base does not mean the change of the aminoacid, because some aminoacids can be coded with more than one codon. In the case of Leucine, the codons that encode it are CUU, CUC, CUG or CUA, so even if a base changes, the final protein will be the correct one.

For the other options:

  • <u><em>Missense</em></u><em>: the change of the base in the DNA chain implies the change of the codon in the mRNA and of the encoded aminoacid, in that way a structural and functional alteration of the synthesized protein occurs. </em>
  • <u><em>Nonsense</em></u><em>: the change in the nitrogenous base in the DNA leads to the coding of a termination codon, so that the protein is ultimately incomplete.</em>
  • <u><em>Insertion</em></u><em>: in this case there is the addition of more nitrogenous bases to the DNA chain, with respect to the original one.</em>
3 0
3 years ago
Read 2 more answers
A scientist observes two cells. cell 1 and cell 2 both contain dna (genetic material) and ribosomes. however, cell 1 contains a
nlexa [21]
What is the question

4 0
3 years ago
Explain stages of anopheles mosquito​
Ainat [17]

Answer:

anopheles mosquitoes is very painles when it is bite in our skin

6 0
3 years ago
On what characteristic of an organism does natural selection exert pressure?
Pie

Answer: option D.

Phenotype

Explanation:

Theory of natural selection shows that different organism survive, adapt and reproduce in their environment due to their different phenotypic variation. The phenotypic variation exist among individual organisms and it is heritable which is transfer from one generation to another.

Phenotype are traits or physical characteristics or observable characteristics of organism e.g organisms appearance, behavior e.t.c.

8 0
3 years ago
Read 2 more answers
A scenario where a cell may need to perform a form of endocytosis
Mademuasel [1]

There are so many examples for that in different areas, like TPBA experiment carried out in our lab recently.Here's one link: http://www.alfa-chemistry.com/tpba-cas-172285-72-2-item-294462.htm

7 0
4 years ago
Other questions:
  • The moon has the most influence on depth of tides true or false
    11·2 answers
  • Why was the evolution of cuticle so important during the evolution of land plants?
    15·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • If DNA has the sequences of bases TCAAGT, the mRNA formed during transcription would have the sequence of
    11·2 answers
  • PLZ NEED HELP ASAP !!!!
    13·1 answer
  • A plant with white flowers was crossed with a plant with red flowers. All of the offspring had pink flowers. Which of these term
    13·2 answers
  • Black fur in labs is dominant (B) and brown fur is recessive (b). how many recessive genes does a lab need in order to have brow
    13·1 answer
  • Label strands of DNA
    7·1 answer
  • The role of dna in cellular differentaation
    6·1 answer
  • For HOW LONG can humans be considered as carbon sinks?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!