All categories

3 years ago

When a cell copies its DNA (replication), the original DNA indder is broken apart and new mucleotides are

Biology

1 answer:

maria [59]3 years ago

4 0

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand

TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand

GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand

GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand

AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

You might be interested in

A population of mice has grown so rapidly that there are 2,400 individuals in an ecosystem that will support about 1,800 mice. t

azamat

undergo a dramatic decline in size, possibly to a stable level at or below 1,800 individuals.

4 0

3 years ago

. What causes a hurricane to form will give brainliest to smartest answer

Archy [21]

Answer:

For one to form, there needs to be warm ocean water and moist, humid air in the region. When humid air is flowing upward at a zone of low pressure over warm ocean water, the water is released from the air as creating the clouds of the storm. As it rises, the air in a hurricane rotates.

Explanation:

In short pressure zones over warm ocean

8 0

2 years ago

Read 2 more answers

Compare and contrast inexhaustible and renewable resources. Plz help I’m despreat

pickupchik [31]

Answer:

Compare and contrast inexhaustible and renewable resources. Inexhaustible resources are sources of energy that will never run out. In contrast, renewable resources could potentially run out. They are finite energy resources that can be replaced in a relatively short period of time.

Explanation:

6 0

2 years ago

Plants use glucose to synthesize cellulose. Which statement accurately describes this process?

Sergeeva-Olga [200]

Answer:

Explanation:

Sugar, which is a product of the photosynthetic process of green plants can be converted to glucose (a simple carbohydrate). Enormous amount of these glucose molecules can be linked together to form a complex carbohydrate called cellulose, which is a polysaccharide because it is made up of a long chain of glucose molecules. The cellulose is ultimately used to build the cell wall of plants.

Anabolism is the production of a complex molecule by a living organism from a much simpler one. Since, cellulose is produced by the building up of glucose molecules, the process can therefore, said to be anabolic

6 0

2 years ago

In the cell, which organelle has the function of using oxygen in the breakdown of glucose, releasing energy and carbon dioxide?

neonofarm [45]

The most appropriate answer is C !!

4 0

3 years ago

Read 2 more answers