1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
goldenfox [79]
3 years ago
13

When the blending of traits occurs, it is referred to as the principle of _____.

Biology
1 answer:
Firlakuza [10]3 years ago
8 0
The answer is incomplete dominance! :)
You might be interested in
Identify one of the mrna codons that would stop the coding process
Rom4ik [11]
UAG encodes for a "stop". 
8 0
4 years ago
1. Why is the oceanic crust easily broken?
11111nata11111 [884]

Answer:

1.Oceanic crust is constantly formed at mid-ocean ridges, where tectonic plates are tearing apart from each other.The age and density of oceanic crust increases with distance from mid-ocean ridges. Just as oceanic crust is formed at mid-ocean ridges, it is destroyed in subduction zones.

2.The plates can be thought of like pieces of a cracked shell that rest on the hot, molten rock of Earth's mantle and fit snugly against one another. The heat from radioactive processes within the planet's interior causes the plates to move, sometimes toward and sometimes away from each other.

3.A place's absolute location is its exact place on Earth, often given in terms of latitude and longitude. For example, the Empire State Building is located at 40.7 degrees north (latitude), 74 degrees west (longitude). It sits at the intersection of 33rd Street and Fifth Avenue in New York City, New York.

8 0
3 years ago
If there is a high death rate and large amount of ________- , populations will likely decrease.
SIZIF [17.4K]

The correct answer is:

Emigration because it means people are moving out, causing the population to decrease along with a death rate.

Explanation:

if there are a high death rate and a large amount of emigration, populations will likely decrease. Emigration relates to an experience when an individual walked out to another place because of some reasons ( the most common one are: Rare resources, societal problems, depression, or solely because they required to try out their fate).

6 0
3 years ago
Read 2 more answers
In which part of the cell cycle do the mitotic spindles assemble, bind to chromosomes, and move the sister chromatids apart?
adelina 88 [10]

Answer:

During prophase, the nucleus disappears, spindle fibers form, and DNA condenses into chromosomes ( sister chromatids ). During metaphase, the sister chromatids align along the equator of the cell by attaching their centromeres to the spindle fibers.

Explanation:

4 0
3 years ago
Determine whether each of the following is a characteristic of DNA, RNA, or both.
user100 [1]

Answer:

pls give the options to answer

5 0
4 years ago
Read 2 more answers
Other questions:
  • What are the four types of membrane proteins and what are their functions?
    15·2 answers
  • What is homeostasis?
    6·2 answers
  • Which is a binary star ?
    15·2 answers
  • What are reasons a animal population would decrease
    14·1 answer
  • Select all that apply. Which of the following is true of vasodilators? Group of answer choices They alleviate edema. They increa
    5·1 answer
  • Nutrients move through ecosystems in different ways. which nutrient cycles through organisms, rivers, rain, and the atmosphere?
    5·2 answers
  • Study the image.
    10·1 answer
  • Which living species share a close evolutionary connection to either humans?
    8·1 answer
  • When individuals in a population repurduce at a constant rate is called
    9·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!