1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
11111nata11111 [884]
3 years ago
7

A biome is a large group of plants and animals living together in a specific _____

Biology
1 answer:
Flura [38]3 years ago
8 0
Environment/ habitat

You might be interested in
_________ blood enters the right atrium; it flows through a valve into the right ________, which pumps it through _______, which
Lerok [7]
Specialized tissue on the wall between the atria. Electrical impulses pass from the pacemaker (SA node) through the _______ and the atrioventricular bundle (bundle of His) toward the ventricles.atrium (pl. atria)One of two upper chambers of the heart.capillary<span>Smallest blood vessel. Materials pass to and from the bloodstream through the thin walls. They have walls that are only one endothelial cell in thickness. This delicate, microscopic vessel carries nutrient-rich, oxygenated blood from the arteries and arterioles to the body cells. There, the nutrients are burned in the presence of oxygen (catabolism) to release energy.
At the same time, waste products such as carbon dioxide and water pass out of the cells and into these blood vessels. Waste-filled blood then flows back to the heart in small venues, which combine to form larger vessels called veins.</span>carbon dioxideGas (waste) released by body cells, transported via veins to the heart, and then to the lungs for exhalation.coronary arteriesBlood vessels that branch from the aorta and carry oxygen-rich blood to the heart muscle.deoxygenated bloodBlood that is oxygen-poor.diastole<span>Relaxation phase of the heartbeat.</span>
7 0
3 years ago
Which of the following vectors holds the largest pieces of DNA?
wolverine [178]

Answer:

c. YACs

Explanation:

YACs, the Yeast artificial chromosomes are the high capacity vectors designed to carry the eukaryotic genes and carry the insert of 200-2000 kb.

YACs carry origin of replication from yeast, selectable markers and sequences derived from telomeres and centromere to maintain the stability of the insert during cell division.

The insert size for plasmids, bacteriophage, PACs, and cosmids is about 0.1-10 kb, 5-25 kb, 100-300 kb, 35-45 kb respectively.

3 0
3 years ago
Drag each tile to the correct box. Explain the process in which hormones secreted by the pancreas function with respect to incre
ValentinkaMS [17]

Answer:

1) intake of glucose molecules from the blood by specific transporters

2) high amount of glucose in the blood, sending signals toward the pancreas

3) binding of hormones with receptors on the liver

4) release of hormones from the receptors

5) synthesis of hormones by beta cells

Explanation:

During ingestion of the meal, insulin is produced in response to high blood glucose levels (concentration of glucose increases after digestion of food). Like other hormones, insulin performed its action through binding specific signals to specific receptors e.g, liver, muscle cells.  The high glucose level in the blood send signals through hormones to liver, fat, and muscle cell receptors. These receptors release specific hormones to beta cells of the pancreas. In response to the signals from receptors, beta cells synthesize insulin to minimize glucose levels in the bloodstream.  

5 0
3 years ago
Read 2 more answers
Which is an example of codominance
ikadub [295]
Roan fur in cattle, in which white and red hair is equally expressed.
6 0
3 years ago
Chlorophyll is most abundent in the blank of a plant
Vesnalui [34]
Well it can be found in cyanobacteria and the chloroplasts of algae and plants.
8 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • "[...] se caracteriza por tiques motores e vocais. Os tiques ocorrem várias vezes por dia podendo ser simultâneos ou em diferent
    13·1 answer
  • Documentation descriptive details of events in nature -amounts,sizes,colors,smell,behavior,texture -for example-eclipse observat
    14·1 answer
  • what is a well tested explanation that brings together many observations in science such as evolution, plate tectonics, biogenes
    14·1 answer
  • Which ecological unit exists as an interdependent system made up of the physical environment and a living community functioning
    13·1 answer
  • True or false: Quartz will scratch minerals in the list, numbered 1 through 6.
    9·1 answer
  • What is the role of DNA in transmitting genetic information? Describe DNA’s important genetic role in few sentences below.
    15·1 answer
  • Large cells are difficult to maintain. How do cells overcome this problem?​
    8·1 answer
  • You have learned that scientists have found physical evidence of the Flood. In this project you will think about Noah and his co
    6·1 answer
  • Help I'm confused!
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!