1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Snezhnost [94]
3 years ago
7

I don’t understand how to do this

Biology
1 answer:
Rudik [331]3 years ago
7 0

Answer:

Translation: GAUGCUUCCAACGACCACTA

Transcription:

GTACGAAGGTTGCTGGTGAT

GATGCTTCCAACGACCACTA

Explanation:

You might be interested in
seeds that are planted upside down are still able to grow into mature plants which explanation best explains this phenomenon?​
pav-90 [236]

Answer:

This question is incomplete but the completed question is below

eeds that are planted upside down are still able to grow into mature plants. Which explanation best explains this phenomenon?

(a)The roots change into branches, and the branches turn into roots.

(b)The roots grow toward the force of gravity, and the shoots grow away.

(c)The plant will become a smaller version of a mature plant.

(d)Roots always grow toward the dark, and shoots grow toward the light.

Two options appear to be correct here: options B and D

Explanation:

Regardless of the direction the seed is planted, the seed has the ability to re-position itself via the help of growth hormones that respond to gravity and redirect the seed into the proper orientation. However, after re-orientation of the seed, the root grows toward the direction of gravity (a process known as gravitropism) while the shoot grows toward the direction of sunlight (a process known as phototropism). Even though two options appear to be correct here, the most correct option based on he question is b

8 0
2 years ago
If the substance entering the cell was in higher consonstration inside the cell than outside the cell ,what type of transport wo
nignag [31]
<span>Facilitated diffusion

Diffusion occurs because of the movement of molecules from the region of higher concentration to the region of lower concentration. This movement of molecules occurs due to a thermal motion. Diffusion normally occurs between two compartments having difference in concentration. In case of fluid it moves from the region of higher concentration to the region of concentration until a balance is reached. The process of diffusion is very important for the humans as well. The oxygen that humans breathe in gets diffused with the blood.<span> </span></span>
3 0
3 years ago
The movement of tectonic plates in two different locations is shown below:
Ostrovityanka [42]

Answer:

Subduction may occur in both locations.

Explanation:

4 0
3 years ago
Read 2 more answers
The phase during mitosis in which chromosomes move into the center of the cell is _____.
Ede4ka [16]
The phase is metaphase. I can remember this because bith "meta" and "middle" start with the letter "m".
8 0
3 years ago
Read 2 more answers
DNA - chromosome - _________: the unit of inheritance in organisms.
rusak2 [61]
Gene is the unit of inheritance
6 0
3 years ago
Read 2 more answers
Other questions:
  • Please helppp taking it now
    7·1 answer
  • How are small leaves an adaptation in a desert environment?
    11·1 answer
  • What unit of measurement is most appropriate for measuring the size of atoms?
    5·1 answer
  • The body monitors the levels of oxygen in the blood to regulate breathing. Isabel is running in a marathon and is near the finis
    15·1 answer
  • Is slate harder than shale?
    7·1 answer
  • A rock climber climbs up the rock wall how do the bones and muscles in his arms interact to allow him to climb up
    10·1 answer
  • What is an important component of ATP that is needed to transfer and release energy directly?
    5·2 answers
  • Which plant-cell organelle supports and maintains the cell's shape and protects the cell Consider this plant cell. The organelle
    15·1 answer
  • Which statement describes what happens to elements during radioactive decay
    5·2 answers
  • 2. Production of oxygen during photosynthesis
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!