1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Snezhnost [94]
3 years ago
7

I don’t understand how to do this

Biology
1 answer:
Rudik [331]3 years ago
7 0

Answer:

Translation: GAUGCUUCCAACGACCACTA

Transcription:

GTACGAAGGTTGCTGGTGAT

GATGCTTCCAACGACCACTA

Explanation:

You might be interested in
What is the formula to solve for mass in specific heat capacity?
Setler79 [48]
Quantity of Heat = Mass x Heat Capacity x Temperature Change 
This may be shortened to: 
q = mcΔT 
where: 
q = Quantity of heat in Joules (J) m = Mass of the substance in grams (g) c = Specific Heat Capacity (Jg-1) ΔT = Change in Temperature (Δ = This symbol is "delta", which is Greek for "change") 
8 0
3 years ago
Genes are segments of DNA that determine the phenotype of an individual. Pea colors can be yellow or green. When two plants that
telo118 [61]

The answer to question 1 is A.

The answer to question 2 is C.

6 0
3 years ago
Read 2 more answers
Which of the following is TRUE about sexual reproduction? Please choose the correct answer from the following choices, and then
Marina CMI [18]

Answer:

The correct answer is A. Sexual reproduction produces a greater variation in offspring.

Explanation:

  • B is wrong because in sexual reproduction there are two organisms involved who combine their DNA, therefore resulting in non-identical offsprings.
  • C is wrong because sexual reproduction requires the two organisms involved to exchange DNA's whereas asexual reproduction involves only one organism which only copies it's own DNA for reproduction.
  • D is wrong because there are no risks as genetic defects and no need to seek a mate or it is easier than sexual reproduction which results in lower risks for the parents in asexual reproduction.
  • E is wrong because asexual production is a more efficient procedure and results in a faster growing population because there is no need to search a mate.
  • The answer is A because in sexual reproduction, two different DNA's from both parents get combined resulting in more variation in offspring. In asexual reproduction, there is only one set of DNA which does not allow the gene's to mix, causing a less diverse offspring.
7 0
2 years ago
Multiple monomers can be linked together to form a:
solmaris [256]

Answer:

Polymer

Explanation:

Monomers can be linked together to form a polymer

8 0
2 years ago
If a father is affected by an X-linked dominant condition and the mother is not, which children can inherit the condition?
kaheart [24]

Answer:

only females

Explanation:

In humans, sex chromosomes in males and females are different. The sex chromosomes found in humans are X and Y chromosomes. X-linked trait is a trait which is inherited on the X- chromosome. According to the question, the trait is passed on a X-linked dominant condition, which means the condition is inherited on the abnormal dominant X-chromosome that will express itself even when in an heterozygous state with a normal X-chromosome.

Hence, a father affected by the condition will have a genotype; XY while a mother that does not have the condition will have a genotype: xx (two normal x chromosomes). Since the Father can only pass his X chromosome to his daughters and never his sons, all his daughters will inherit the condition (see the punnet square in attached image).

N.B: None of the sons will inherit the condition since the mother will pass normal X-chromosomes (x) to her sons.

7 0
3 years ago
Other questions:
  • How does competition influence population size
    15·1 answer
  • Leia um parágrafo que aponta o agente causador da gripe e cita um exemplo de tr?s grandes pandemias dessa doença?
    8·1 answer
  • Driving automobiles and burning coal for electricity are examples of two human activities that negatively impact _______.
    5·1 answer
  • Compare and contrast RNA and DNA
    8·1 answer
  • The Mechanical Breakdown of rocks by the action of other rocks and sand particles is called
    9·1 answer
  • What is the relationship between a gene and a allele
    12·1 answer
  • Does cell city represent a plant cell or an animal cell? Explain your answer
    7·1 answer
  • Some people who take beta blockers get out of breath when they exercise.
    6·1 answer
  • Why is the circulatory system of insects not involved in the respiratory mechanism of insects?​
    12·1 answer
  • HELP !!
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!