1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Snezhnost [94]
3 years ago
7

I don’t understand how to do this

Biology
1 answer:
Rudik [331]3 years ago
7 0

Answer:

Translation: GAUGCUUCCAACGACCACTA

Transcription:

GTACGAAGGTTGCTGGTGAT

GATGCTTCCAACGACCACTA

Explanation:

You might be interested in
The equation of line e is y = 3/5x + 1. The equation of line f is y = -8/3x + 9/8. Are line e and
serg [7]

Answer:

I think they're neither perpendicular nor parallel

Explanation:

Not parallel since slope of e (3/5) isn't equal to slope of f (-8/3)

Not perpendicular since the product of their slopes isn't equal to - 1.

=> (3/5)(-8/3)= - 8/5 and not - 1

(plz make sure you typed the equations correctly.)

Hope this helps..

5 0
3 years ago
Plz answer any short answer plzzzz<br> I will mark brainlest
kvv77 [185]
A. Antarctic blue whale

B. Herbivores

C. Inland Taipan

D. “The scientific name Asteroidea was given to starfish by the French zoologist de Blainville in 1830. It is derived from the Greek aster, ἀστήρ (a star) and the Greek eidos, εἶδος (form, likeness, appearance). The class Asteroidea belongs to the phylum Echinodermata.”

E. “First, primates have larger eyes than many other mammals of comparable body size (Ross & Kirk, 2007). Having large eyes ensures that a large image is formed on the retina (Walls, 1942; Land & Nilsson, 2002). This large retinal image may then be sampled by many photoreceptors, improving visual resolution. Primates have flexible shoulder joints and and strong clavicles or collar bones that help them use their arms more effectively than other species of animals. Most primate can hold their bodies erect and some species, including humans, can walk on two legs instead of four.”
7 0
3 years ago
the slash and burn system of deforestation reduces the number of oxygen producing and puts more carbon in the air
LekaFEV [45]
I think you wanted to know whether the statement in question is true or false. Based on this assumption, i am answering this question and hope that it helps you. It is absolutely true that the slash and burn system of deforestation reduces the number of oxygen producing and puts more carbon in the air.
8 0
3 years ago
Read 2 more answers
_____ play a vital role in recycling nutrients and creating a balance of Earths materials
mart [117]
C. :)

hope i helped - beanz
5 0
3 years ago
Read 2 more answers
Exoplanets are planets that _____.
lesantik [10]

Answer: The exoplanets are the planets which orbit stars other than the sun.

Explanation: Exoplanets are also known as extra solar planets which means that these planets revolve or orbit around the stars other than the sun.

Exoplanets does not belong to our solar system because in our solar system, the planets orbit around the star named as sun.

Examples of exoplanets are Kepler-186f , 55 Cancri e.

6 0
3 years ago
Read 2 more answers
Other questions:
  • What are two important fuels that comes out of the oil refining process?
    5·1 answer
  • Glucose is a form of sugar found in the blood Cells use glucose as a source of energy, but too much or too little can cause seri
    13·2 answers
  • Why are palindromes important to genetic engineers
    14·1 answer
  • Which statement describes scientific studies about fossil fuels that are related to politics
    8·1 answer
  • DeShawn is studying homeostasis and circulation. To organize his findings, he constructs two models of the human heart, veins, a
    8·1 answer
  • Deciduous forests receive 75 cm of rainfall each year, making plant growth plentiful. What type of animals live in these forests
    13·1 answer
  • Please as help! Explain how important has been for animals to have internal fertilization? Provide two
    11·1 answer
  • How do neutral mutations to DNA cause inheritable genetic variations?
    14·1 answer
  • 4. <br> When a Na atom, loses one electron, it gets a charge of _______.<br><br> -1<br><br> +1
    11·2 answers
  • DNA definition in your own words
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!