1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Snezhnost [94]
3 years ago
7

I don’t understand how to do this

Biology
1 answer:
Rudik [331]3 years ago
7 0

Answer:

Translation: GAUGCUUCCAACGACCACTA

Transcription:

GTACGAAGGTTGCTGGTGAT

GATGCTTCCAACGACCACTA

Explanation:

You might be interested in
The _____ of the brain is more active during visual imagery encoding. inner left temporal lobe lower left frontal lobe upper lef
bazaltina [42]

Answer:

parietal and occipital cortices

Explanation:

4 0
2 years ago
During pregnancy, a cell undergoes what appears to be a normal mitotic nuclear division. However, two daughter cells with 2n-1 a
dem82 [27]

Answer:

c. Two sister chromatids did not separate into the proper daughter cells during anaphase.

Explanation:

The observed cell is undergoing mitosis which does not include separation of homologous chromosomes. During anaphase of mitosis, two sister chromatids of each chromosome separate from each other. They move to opposite poles. This results in equal distribution of two complete sets of chromosomes to each daughter cell.

However, the failure of two sister chromatids of a chromosome during anaphase would lead to the formation of two abnormal daughter cells. One of the daughter cells would have one extra chromosome (2n+1) while the other would lack one chromosome from the diploid set (2n-1).

8 0
3 years ago
While out bird-watching, Samantha took this picture. She was in an area of shallow water, surrounded by grassy plants. She saw a
Paraphin [41]

Answer:

marsh

Explanation:

  • Marsh is a type of wetland that is usually formed in the areas of transition between aquatic and terrestrial ecosystems.
  • Marsh is dominated by herbaceous species such as grasses, reeds, etc.
  • In a marshland that is a variety of birds and animals that can be found.
  • These are usually formed near lakes or streams.
  • Since the place where Martha was present has all these characteristics she was most likely in a marsh.
4 0
4 years ago
Read 2 more answers
__________ forms a liquid cushion for cns structures. __________ forms a liquid cushion for cns structures. the pia mater cerebr
atroni [7]
Cerebrospinal Fluid

Produced by the choroid plexuses of the brain, the cerebral spinal fluid is contained in the subarachnoid cavity and spinal canal. It is reabsorbed by the arachnoid granulations.
Besides acting as a cushion for the CNS, the cerebral spinal fluid plays a critical part in the immunology of the central nervous system, blood flow in the CNS and autoregulation.

6 0
3 years ago
The loss of color (coral bleaching in coral reef organisms can be a result of
pav-90 [236]
Hello there ^ _ ^

The loss of color(coral bleaching in coral reef organisms can be a result of <span>loss of zooxanthellae.


Good luck!


</span> 
7 0
3 years ago
Other questions:
  • The neurons of the central nervous system are also known as ________.
    9·1 answer
  • Intercellular space are absent in sckeranchymatons tissues give reasons
    7·1 answer
  • Glacial erosion can shape many landforms, including cirques. What is a cirque?
    7·1 answer
  • 3TC is an antiretroviral treatment used to prevent HIV infection from becoming AIDS. After treatment with 3TC, the HIV populatio
    10·1 answer
  • Which of the following is not part of the cell theory? Every living thing is composed of cells. Cells come from preexisting cell
    11·2 answers
  • what elements are in the most common substance in the human body? a. carbon and nitrogen b. hydrogen and oxygen c. oxygen and ph
    15·1 answer
  • All living things are made of organic compounds which contain the element:
    10·2 answers
  • What is the act of adding water to crops?
    13·2 answers
  • Which gene determines what letter is used to represent a pair of traits?
    7·1 answer
  • What is the term that represents excessive plant growth in water that causes large amounts of inorganic substances, such as phos
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!