1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Snezhnost [94]
3 years ago
7

I don’t understand how to do this

Biology
1 answer:
Rudik [331]3 years ago
7 0

Answer:

Translation: GAUGCUUCCAACGACCACTA

Transcription:

GTACGAAGGTTGCTGGTGAT

GATGCTTCCAACGACCACTA

Explanation:

You might be interested in
Explain the relationship between genotype and phenotype. How can one phenotype result from more than one genotype?
koban [17]

Answer:

<h2>Genotype is the set of genes( allele) of an organism. </h2><h2>Phenotype is the physical expression of the genetic composition of an organism. </h2>

Explanation:

Genotype: 1. It is the genetic composition of an organism, means it is the set of genes( allels) of an organism's DNA, which is responsible for a particular trait of an organism.  

2. Genotypically, an organism can be homozygous(dominant or recessive) or heterozygous.  Some Alleles are dominant over other, means some can  be dominant or other can be recessive.  

3. Genes are responsible for all the traits in an organism, and these traits are inheritable. All the offsprings inherit all traits from their parents.  

Phenotype: 1. Physical expression of the genetic composition of an organism resulted as  phenotype.

2. It  is the physical expression of genes (alleles) which are responsible for any trait.

5 0
3 years ago
During one year, seven coyotes in a population die. Eight immigrate into the population, but none emigrate. If the overall popul
Tpy6a [65]
Death rate= 7 coyotes
Immigration= 8
Emigration= 0
Population growth= 13
Let’s suppose that the birth rate for the given population is x.

Population growth = (birth rate+immigration) - (death rate+emigration)

13=(x+8)-(7+0)
13=x+1
Move the variable to the left side and change its sign.
-x+13=1
Move the constant to the right side and change its sign
-x=1-13
-x=-12
x=12
Answer: x=12

Hope this helps ʕ•ᴥ•ʔ
8 0
3 years ago
Read 2 more answers
Which of the following most accurately describes the setting that created the need for antiknock compounds in gasoline and new r
Rashid [163]

Answer:

d.

Explanation:

they were needed to reduce carbon monoxide in our environment to sustain fresher air, less pollution and wildlife..

6 0
3 years ago
Due to a sudden rise in a nearby river, the nurse at a day camp evacuates the children to an area away from the river. which act
earnstyle [38]
The nurse should call for help or wait until help arrives.
8 0
3 years ago
Please answer this question:)​
Shkiper50 [21]

Answer:

meiosis 1

Explanation:

7 0
3 years ago
Other questions:
  • Smooth muscle activity in the small intestine wall facilitates chemical digestion and absorption employing the processes of segm
    7·1 answer
  • When did darwin arrive on the galapagos islands
    9·1 answer
  • What is the shape of an Acid-fast bacteria?
    5·1 answer
  • Metamorphic rocks tend to show the same properties as the rocks they were formed from Question 3 options: True False
    12·2 answers
  • What drug that is not an antibiotic is approved for the specific indication of sepsis because of its anticoagulant properties?
    13·2 answers
  • Hydroxyapatities are?
    14·2 answers
  • by sensing and responding to change organisms keep conditions in the internal enviornment within ranges that cells can tolerate
    8·1 answer
  • What are the phases of Mitosis and what happens in each phase?
    6·1 answer
  • How does Fluid balance maintain homeostasis
    15·1 answer
  • 6. Circle the domain that describes each property.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!