1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Snezhnost [94]
3 years ago
7

I don’t understand how to do this

Biology
1 answer:
Rudik [331]3 years ago
7 0

Answer:

Translation: GAUGCUUCCAACGACCACTA

Transcription:

GTACGAAGGTTGCTGGTGAT

GATGCTTCCAACGACCACTA

Explanation:

You might be interested in
If meiosis failed to occur in both male and female worms the zygote nucleons would resemble diagram
den301095 [7]

Tetraploidy will occur.

<h3><u>Explanation</u>:</h3>

The process of sexual reproduction is very necessary to maintain the genetic setup of the species over the races.

The normal chromosome content of a cell is called diploid state of cell. Its represented by the expression 2n. The cell division that takes place before the gamete formation is called meiosis. This cell division makes the chromosome number of the cells halved. So haploid cells are produced. Its represented by n.

Now as the gametes fuse, both the n becomes 2n and diploid state is regained.

But if the meiosis don't occur in the gametes, the gametes will remain 2n. So after fertilization, it becomes 4n. This state is called tetraploidy.

6 0
3 years ago
Why do you need a microscope to determine if something is living?
Sedaia [141]

Answer:

67

Explanation:

4 0
3 years ago
__________ death rates and __________ infant mortality rates are due in large part to technological advances, improved sanitatio
Elis [28]
<h2>Both are Lower</h2>

Explanation:

  • Death rate is also known as Mortality rate.
  • Death rate is the ratio of total deaths to total population in a specific area  or community over a specific time period.
  • Death rate = number of deaths/1000 of the population/year.
  • The death of young children under the age of 1 is known as Infant mortality rate.
  • The infant mortality rate (IMR) meausres the death toll which is the number of deaths of children under one year of age /1000 live births.  
4 0
3 years ago
5 tips to improve your critical thinking - Samantha Agoos
Maksim231197 [3]

Answer:

that one is hard because we did not see the vidoe

Explanation:

8 0
2 years ago
The introduction describes research into unusual bacteria capable of living in an extremely harsh environment. The introduction
Iteru [2.4K]

Answer:

Basic Research

Explanation:

The initial discovery and analysis of the Lake Vida bacteria allowed them to be classified thereby leading to an understanding of their basic metabolic processes.

Although ,the introductory passage suggested several ways that this could lead to applied research by allowing the development of new products.

Conclusively, the research is a basic in nature because it gave a better understanding of the natural world.

7 0
3 years ago
Other questions:
  • Which is produced by the endocrine system to control how cells and organs function?
    14·2 answers
  • Can someone plz help me!!!!!!!!!!!!! this is my last question!!!!!!!!!!!!
    11·1 answer
  • What are the names of the four nucleotides? ​
    6·1 answer
  • How does your body stop viral infections? What are ways of protection against viral infection?
    12·2 answers
  • Which description of synapses is not correct? which description of synapses is not correct? second messengers can activate gene
    5·2 answers
  • What is the “Symbiotic Theory” and how does it fit in with cells?
    13·1 answer
  • What was the main thing traded on the silk road?
    9·2 answers
  • Think of an activity you did today. Using what you learned in this module, describe at least five different parts of your brain
    7·1 answer
  • In this class we are exploring different career options available to today's students.
    11·1 answer
  • When minute samples of DNA need to be genetically analyzed for identification purposes, which test can be effectively used to ma
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!