Answer:
The ocean produces over half of the world's oxygen and absorbs 50 times more carbon dioxide than our atmosphere. Climate regulation: Covering 70 percent of the Earth's surface, the ocean transports heat from the equator to the poles, regulating our climate and weather patterns.
The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.
<h3>What is a sense DNA strand?</h3>
DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.
During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.
In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.
Learn more about transcription here:
brainly.com/question/1048150
A thoracic aortic aneurysm is a weakened area in the upper part of the aorta. The aorta is the major blood vessel that feeds blood to the body.
The best and most correct answer among the choices provided by your question is the third choice.
Atrophy occurs when a muscle becomes weaker and smaller from not being used
I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!
The answer is B. a community <span>interaction.
Let's distinguish some terms:
A population is a group of organisms of the same species in an area. If there were a herd of only zebras, this would be a population interaction.
<em>A community is a group of organisms from different species in an area. </em></span><span><em>A herd of zebra eating grass includes groups of organisms from different species is an example of a community interaction.</em>
An ecosystem consists of all organisms (from different species) in an area and their physical environment.
A biome is a large area defined by abiotic factors.</span>
