They may either release heat or gain heat. With a temperature increase, the kinetic energy increases and the state of matter will increase (example, ice to water aka solid to liquid)
If the temperature decreases, then the kinetic energy decreases and the state of matter will decrease (example, water vapor to water aka gas to liquid)
Have a nice day!
I hope this is what you are looking for, but if not - comment! I will edit and update my answer accordingly. (ノ^∇^)
- Heather
Answer:
AIDS
Explanation:
AIDS is the most common infectious disease causing lymphocytopenia, which arises from destruction of CD4+ T cells infected with HIV.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
In this lab, you dissected a flower. The modified leaves that surround the reproductive parts are called petals. These structures help attract pollinators to the flower. The pistil is the female reproductive organ, which contains three segments: the stigma, style, and ovary.
Answer:
idhar re baba
....,.......,....................
