1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kondaur [170]
3 years ago
6

Also known as the variety of life? ​

Biology
1 answer:
Amiraneli [1.4K]3 years ago
7 0

Answer:

What Should or What do you want

should be known as . variety of life.

You might be interested in
Tigers can have orange or white fur. Orange is a dominant fur color, while white is recessive.
VLD [36.1K]

I had to put the answer in the image sorry

7 0
3 years ago
What is a triacylglycerol ? Discuss the advantages of organisms having triacylglycerol as energy storage molecule?
Sergeeva-Olga [200]

Answer:

Triacylglycerols are acylglycerols with three fatty acid molecules, generally long chain, which can be the same or different; we speak of simple triacylglycerols when there is the same fatty acid in all three glycerol positions, but most are mixed triacylglycerols, with at least two different fatty acids. The properties of triacylglycerols will depend on the type of fatty acids they contain.

Most of the fats and oils of both animal origin (tallow, butter) and vegetable (olive, corn, sunflower, palm, and coconut oils) are formed almost exclusively by triacylglycerols.

Physiologically, triacylglycerols are an important energy reserve. In most eukaryotic cells, triacylglycerols are stored in the cytosol as microscopic fat droplets. In vertebrates there are specialized cells in the storage of fat, adipocytes. In humans, the presence of fatty tissue under the skin, in the abdominal cavity and in the mammary gland stands out.

5 0
3 years ago
Over the last several decades, the scientific community has gathered a large amount of information regarding genetics and geneti
Alenkinab [10]
<span>The two main sources that lead to increased genetic variation are:

</span>1. Gamete mutations
2. Recombination.

Gamete mutations:
Gametic mutations are the mutations that occur in germline cells (sperm and egg). Due to this, the mutations are able to be passed on from one generation to another. One of the most famous gametic mutations<span> is hemophilia.
</span>
Recombination:
Genetic recombination is the production of offspring with combinations of traits that differ from those found in either parent.
7 0
4 years ago
What are the subunits of ATP
VMariaS [17]
The purine base adenine
The pentose sugar ribose
<span> Three phosphates </span>
6 0
3 years ago
The chromosome are arranged to show
nekit [7.7K]

Answer:

D. nucleotides

i'm not sure

3 0
3 years ago
Read 2 more answers
Other questions:
  • Now that you have learned about indicator solutions, write a hypothesis to answer the lesson question, “What macromolecules are
    15·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • The part of a neuron which contains the nucleus and has a complete set of the neuron
    15·2 answers
  • Small circular rna molecules that infect plants and disrupt their growth ______.
    14·1 answer
  • How does current theory explain the origin of a nucleus in eukaryotic cells? Please choose the correct answer from the following
    11·1 answer
  • PLZ HELP is oxygen a fluid
    8·2 answers
  • Is there two characteristics of a plant cell
    9·1 answer
  • Which factor determines who a society will produce goods and services for?
    12·2 answers
  • Identify which of the blood vessels<br> are blue in color and explain why,
    7·1 answer
  • Look at this picture! Can you tell what type of stone that is?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!