1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexira [117]
3 years ago
15

Similar structures that evolved independently are called

Biology
1 answer:
poizon [28]3 years ago
4 0
Similar structures that evolved independently are called analogous structures
You might be interested in
consuming high levels of provitamin a carotenoids, which come from plant sources, does not lead to vitamin a toxicity.
Feliz [49]

Consuming high levels of pro vitamin A carotenoid, which come from plant sources, does not lead to vitamin A toxicity. This statement is true.

Vitamin A is obtained mainly from the food products we eat, but it is also synthesized in our body via pro vitamin A carotenoids like beta-carotene. When high amounts of pro vitamin A carotene are consumed in the diet of a person they are converted very slowly and naturally in our body into vitamin A in the intestine.

Vitamin A has many benefits including defense from pathogens, strengthening immune system, improving vision, and also improving overall growth and development of the body etc.

To know more about vitamin A refer to the link below

brainly.com/question/9179407

#SPJ4

6 0
1 year ago
TRNA anticodons how to do them ?
PIT_PIT [208]

Answer:

By using sequence information from covalently attached nucleotides.

Explanation:

TRNA presents an anticodon sequence to required sites as a physical bridge with elongation factors (proteins) to form a connection between mRNA and ribosome and encode amino acids to ultimately form specific protein structure. tRNA carries out this activity by using sequence information from covalently attached nucleotides.

3 0
2 years ago
Read 2 more answers
What are enterocoelous and schizocoelous organisms?
Mars2501 [29]
Schizocoely is a process by which some animal embryos develop while splitting the mesodermal embryonic tissue. On the other hand, <span> enterocoelous was formed </span><span>in which the coelom forms from pouches "pinched" off of the digestive tract.</span>
6 0
3 years ago
Hee Sun drew an electron dot diagram of a silicon atom as shown. In addition to changing the symbol to C, how would this diagram
disa [49]

the answer is B) The same number of dots would appear in the diagram for carbon.

5 0
3 years ago
Read 2 more answers
Research indicates that as levels of happiness increase, cortisol levels appear to increase as well. Please select the best answ
iogann1982 [59]

Cortisol hormones are stress hormones that increase blood glucose levels. When the level of happiness increases the level of cortisol does not increase.

<h3>What are cortisol and its function?</h3>

Cortisol is the steroidal hormone that is produced in the cortex of the adrenal glands and is discharged in the blood vessels when in stress or danger.

It has a variety of functions including regulation of the blood pressure, response to the stressful condition and increase of the metabolism of the body.

It also acts as happiness hormones along with adrenaline and oxytocin but is a major flight or fight hormone and increases the heart rate in dangerous conditions.

Therefore, the statement is false.

Learn more about cortisol here:

brainly.com/question/26291522

3 0
2 years ago
Other questions:
  • Organ systems are composed of organs, organs are composed of tissues, and tissues are composed of cells.
    5·2 answers
  • What are the two most important driving forces of metamorphism?
    15·1 answer
  • Which of the following is true about the Calvin cycle?
    14·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • 1. Explain the difference between genes and alleles.
    5·1 answer
  • _____ is when one allele completely masks another.
    11·2 answers
  • 3. Describe the working of the body's nonspecific defenses<br> against disease.
    15·1 answer
  • A group of scientists must complete a study, but they have limited funding from a government organization. What
    14·1 answer
  • 2. A cell membrane is made up of a(n)
    8·1 answer
  • When minute samples of DNA need to be genetically analyzed for identification purposes, which test can be effectively used to ma
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!