1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Liono4ka [1.6K]
2 years ago
15

What are the two most important driving forces of metamorphism?

Biology
1 answer:
krok68 [10]2 years ago
6 0

The two most important driving forces of metamorphism is high heat and pressure. Metamorphism is the changes in mineral, texture and chemical composition that occurs when a rock undergo conditions such pressures and temperatures that are different from those under which the rock was initially formed. Metamorphism occurs at high temperatures and pressures.







You might be interested in
What is the purpose of the stripes kn the giranium plant
kipiarov [429]

Answer:

the plant produces essential oils in small glands around the foliage and flowers.

Explanation:

3 0
3 years ago
What is the name for the process in which an ovary releases a ripened egg each month
max2010maxim [7]
That process is known as "Ovulation"

Hope this helps!
7 0
2 years ago
Which is the source of energy, which drives the water cycle?
kotegsom [21]

Answer:

it's the sun

Explanation:

the water cycle is driven primarily by the energy from the sun

7 0
2 years ago
Does a chameleon eat a frog?
Deffense [45]

Answer:

Explanation:

A chameleon will eat whatever it can fit in its mouth and then some. I'm sure they eat frogs in the wild, I don't think they know the difference between a frog or an insect just a food idem to them.

7 0
2 years ago
Question:
snow_lady [41]

The statement that is true regarding the reactions that occur in the Calvin cycle is that it consumes energy.

<h3>What is Calvin cycle?</h3>

Calvin cycle of photosynthesis is a series of biochemical reactions that take place in the stroma of chloroplasts in photosynthetic organisms.

The Calvin cycle also called light independent or dark reaction is the second stage of the photosynthetic process. It is so called because it does not require light to occur.

The Calvin cycle makes use of the products of the light stage (ATP and NADPH) to synthesize carbohydrates.

However, the series of reaction is an energy consuming one, which makes use of ATP to occur.

Therefore, the statement that is true regarding the reactions that occur in the Calvin cycle is that it consumes energy.

Learn more about Calvin cycle at: brainly.com/question/3199721

#SPJ1

7 0
1 year ago
Other questions:
  • What is the path that sperm travels, starting from the seminiferous tubules and ending at the location of fertilization?
    15·1 answer
  • An endocrine axis describes:
    8·1 answer
  • Adaptions give organisms a better chance for
    5·1 answer
  • Which of the following is an example of homeostasis?
    15·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which of the following molecules is NOT an organic compound?
    14·1 answer
  • What happens immediately after a mass extinction to the diversity of organisms what happens thousands or millions of years later
    9·1 answer
  • The fish left their habitat for a nicer environment.<br> What the plural noun?
    10·1 answer
  • The enzyme that synthesizes rna primers for use in dna replication is _______________.
    7·1 answer
  • How energy is changed in from as it flows between organisms
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!