1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amm1812
3 years ago
14

In studying the origin of the universe, one of the primary unanswered questions is _____. what type of elements formed first app

roximately how long ago it occurred how long it took the earth to form what came before the big bang
Biology
2 answers:
Virty [35]3 years ago
4 0

Answer:

In studying the origin of the universe, one of the primary unanswered questions is <u>what came before the big bang.</u>

Explanation:

The big bang theory can be described as a theory which scientists have proposed to explain how the universe came into existence. This theory predicts how the extremely hot temperatures and dense atmosphere might have given rise to the stars and the galaxies.

Scientists have no idea what happened before the big bang theory. Some scientists predict that there might be another universe which collapsed before the big bang theory. While other scientists claim that there was nothing before the big bang.

Alex73 [517]3 years ago
3 0

Answer:

What came before the big bang.

Explanation:

The Big Bang Theory is a model for the origin of the universe. The model describes the change that the universe has gone through from its conception. It argues that the universe expanded from a high-density and high-temperature state. However, one of the questions that remain unanswered is what came before the Big Bang, as we do not have the knowledge yet to determine whether this event was primordial.

You might be interested in
Evaluate the analogy of tropical rain forests being referred to as the "lungs" of earth.
xenn [34]

Answer:

Tropical- rain forests are considered to be the lungs of the  Earth due to their role in the carbon-oxygen cycle. The rain forests take in carbon dioxide and release oxygen into the Earth hence, providing the Earth with an abundance of oxygen. The working of these tropical rain forests is just like the working of our lungs, lungs remove carbon dioxide from the body and supply oxygen. Tropical rain forests carbon dioxide for the Earth and supplies it with oxygen.

8 0
3 years ago
What biomes spans the largest annual mean temperature range
OlgaM077 [116]

Answer: Desert spans the annual mean temperature range.

Explanation:

Biomes are large ecological community of plant and animal on the earth surface that have characteristics for the environment they live in. A desert is an example of biomes. It is a barren area of land where there is high temperature and low precipitation (rainfall). It is a place where living conditions is difficult. Lact of vegetation exposed the areato direct sunlight and there is increased temperature. Desert are formed by weathering process I.e the breakdown of rocks into smaller particles through the activities of some agent like water or wind.

4 0
3 years ago
Which of the following correctly describes the image below?
BartSMP [9]

Answer:

Amino acid

Explanation:

Because Amino acids consist of an amino group (NH2) , carboxylic group (COOH) and radical (R).

7 0
3 years ago
Which of the following statements best explains how roots aggregate soil?
SSSSS [86.1K]

Answer:

the hair and tendrils of roots grasp the soil and bind the particles together

Explanation:

just did it on edge :D

5 0
3 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Other questions:
  • The graph below compares the rates of reaction of a burning candle and an exploding firework.
    11·2 answers
  • Solar panels (photovoltaic cells) still work when the panel is shaded.
    12·1 answer
  • PLEASE HELP!
    6·1 answer
  • I make up cell membranes. what am i?
    15·1 answer
  • Tasha went on a trekking exposition to a mountain range during her vacation when she reached a particular height it started taki
    10·1 answer
  • (PLZ READ, TRANSLATE IF U HAVE TOO)
    8·2 answers
  • Compare and contrast the adaptations of free-living flatworms and parasitic flatworms
    13·1 answer
  • Which is true?
    9·1 answer
  • A strain of E. coli is genetically engineered in which the lacZ and lacI genes are removed and replaced with a gene encoding a f
    7·1 answer
  • Parts of a plant cell newsela article
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!