Answer:
Tropical- rain forests are considered to be the lungs of the Earth due to their role in the carbon-oxygen cycle. The rain forests take in carbon dioxide and release oxygen into the Earth hence, providing the Earth with an abundance of oxygen. The working of these tropical rain forests is just like the working of our lungs, lungs remove carbon dioxide from the body and supply oxygen. Tropical rain forests carbon dioxide for the Earth and supplies it with oxygen.
Answer: Desert spans the annual mean temperature range.
Explanation:
Biomes are large ecological community of plant and animal on the earth surface that have characteristics for the environment they live in. A desert is an example of biomes. It is a barren area of land where there is high temperature and low precipitation (rainfall). It is a place where living conditions is difficult. Lact of vegetation exposed the areato direct sunlight and there is increased temperature. Desert are formed by weathering process I.e the breakdown of rocks into smaller particles through the activities of some agent like water or wind.
Answer:
Amino acid
Explanation:
Because Amino acids consist of an amino group (NH2) , carboxylic group (COOH) and radical (R).
Answer:
the hair and tendrils of roots grasp the soil and bind the particles together
Explanation:
just did it on edge :D
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein