1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexgriva [62]
3 years ago
15

Conservation biologists provide strong arguments about why we should all care about preserving biodiversity. When considering th

e resources we get from nature as well as the services the ecosystem perform, it is clear that life on Earth is threatened when biodiversity itself is threatened. Which of the following are services by natural, well-functioning ecosystems?
Nutrient cycling

Decomposition of dead orangisms

Dispersal of pollen and seeds

Increase in ambient global temperatures

Purification of air and water

Reduction in the severity of drought and floods

Pollination of crops and natural vegetation

An increase of erosion and siltation along waterways

Source of medicines

Recyling energy to be used again

Regulation of oxygen and carbon dioxide levels
Biology
1 answer:
Ahat [919]3 years ago
5 0

Answer:Increase in ambient global temperatures.

Recyling energy to be used again

Regulation of oxygen and carbon dioxide levels

An increase of erosion and siltation along waterways

Explanation:

Conservational biologists think about the preservation of ecosystem by maintaining the environment in a human control way.

Increase in ambient global temperatures.: The humans must prevent the increase in global temperature worldwide by preventing the rise of greenhouse gases which can lead to global warming worldwide.

Recyling energy to be used again: The sources of energy like wood, waste water can be recycled again for reutilization.

Regulation of oxygen and carbon dioxide levels.: The oxygen and carbon dioxide levels must be regulated. As oxygen is the basic requirement for respiration. The increase in carbon dioxide levels due to human activities is likely to cause respiratory diseases and health hazards in living beings.

An increase of erosion and siltation along waterways.: The erosion and siltation will likely to deposit nutrients and debris which may either contaminate the waterway or may cause eutrophication.

You might be interested in
which is not a function of the cell membrane? a) to control what enters and leaves b) to protect the cell’s contents c) to provi
Nataliya [291]
D)- to supply hormones. 
3 0
3 years ago
Read 2 more answers
Adaptive defenses include humoral immunity only. Memory B cells areproduced as soon as the B cell binds to an antigen. Adaptive
Rina8888 [55]

Answer:

Adaptive defenses include both humoral and cellular immunity.

Explanation:

The innate immune response is the non-specific immune response and serves to provide an immediate and general immune response. The adaptive immune responses are the specific immune responses. Adaptive immune responses include cell-mediated immunity and antibody-mediated immunity.

Cell-mediated immunity includes T cells (cytotoxic and helper T cells) while antibody-mediated immunity includes the production of antibodies from B cells. Binding of antigen to B cells is followed by their transformation into plasma cells and produce antibodies. Some of the activated B cells form memory B cells that are responsible for quicker and strong secondary immune responses.

5 0
3 years ago
A dna replication bubble forms at a specific sequence of bases called the ___________. see section 15.3 (page 321) .
julsineya [31]

The answer is the origin of replication. This is where the replication bubble is formed. Two opposite replication forks (Y-shaped regions) of DNA are formed when the double helix is unzipped by DNA helicases. Transcription factors, polymerase III and primer then bind to the region to begin transcription.






4 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
The many species of tree frogs that inhabit forests in the eastern US maintain their genetic isolation from other species by sev
Elena L [17]

Answer:

b. behavioral isolation

Explanation:

It is a type of reproductive barrier that can lead to speciation. Behavioral behavior, such as mating rituals as in when two populations of the same species show some difference in behavior, typically in mating rituals

and signals.

8 0
3 years ago
Other questions:
  • What is one way atmospheric nitrogen can be changed into ammonia?
    9·2 answers
  • What is the difference between evaporation and transpiration?
    7·2 answers
  • The function of the ribosome in polypeptide synthesis is to
    14·1 answer
  • Pepsin, an enzyme that is found in the stomach of humans, functions in breaking down proteins. It is denatured as it travels to
    12·1 answer
  • What happens to pyruvate molecules formed in glycosis in the absence of oxygen
    12·1 answer
  • NADH and FADH are produced by the Citric Acid Cycle (CAC) and these electron shuttles go on to the Electron Transport Chain (ETC
    14·1 answer
  • The lungs remain inflated because ___________.a. intrapleural pressure is exactly equal to atmospheric pressure b. intrapleural
    15·1 answer
  • Extinction occurs when a species dies out completely. Which of the following is a major factor leading to extinction?
    9·2 answers
  • High concentrations of ____ (a polypeptide molecule produced by alpha cells to maintain normoglycemia during periods of fasting)
    5·1 answer
  • What is the chemical composition of a bone?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!