Answer:
Adaptive defenses include both humoral and cellular immunity.
Explanation:
The innate immune response is the non-specific immune response and serves to provide an immediate and general immune response. The adaptive immune responses are the specific immune responses. Adaptive immune responses include cell-mediated immunity and antibody-mediated immunity.
Cell-mediated immunity includes T cells (cytotoxic and helper T cells) while antibody-mediated immunity includes the production of antibodies from B cells. Binding of antigen to B cells is followed by their transformation into plasma cells and produce antibodies. Some of the activated B cells form memory B cells that are responsible for quicker and strong secondary immune responses.
The answer is the origin
of replication. This is where the replication bubble is formed. Two opposite replication
forks (Y-shaped regions) of DNA are formed when
the double helix is unzipped by DNA helicases. Transcription factors, polymerase III and primer then bind to the region
to begin transcription.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
b. behavioral isolation
Explanation:
It is a type of reproductive barrier that can lead to speciation. Behavioral behavior, such as mating rituals as in when two populations of the same species show some difference in behavior, typically in mating rituals
and signals.