1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnoma [55]
3 years ago
12

Through which material would sound travel the fastest?

Biology
2 answers:
dedylja [7]3 years ago
6 0

Answer:

A

Explanation:

jasenka [17]3 years ago
4 0
Sound travels fastest through solids and liquids more than it does in gases since the molecules are more tightly packed.

Thus the answer would most likely be C.Steel
You might be interested in
Motor proteins provide for molecular transport of materials in cells by interacting with what types of cellular structures
gogolik [260]
Motor proteins provide for molecular transport of materials in cells by interacting with CYTOSKELETAL STRUCTURES.
Cytoskeletal structures refers to those structures in the cells that provide basis for movement from one part of the cell to another.
Motor protein work together with cytoskeletal structures to carry different type of materials from one point of the cell to another point.
7 0
3 years ago
What are the steps of muscle contraction?
murzikaleks [220]
It's more like something losing its power
3 0
3 years ago
Does cellular respiration follow the law of conservation of energy?
k0ka [10]

Yes. Every chemical reaction obeys the law of conservation of mass.

Believe it!!

Pls follow me.

8 0
3 years ago
The process of genetic engineering may include either four or five steps. The diagram represents the five-step process. Which be
larisa [96]

The Answer Is A!!!!!!!!!!!

3 0
3 years ago
Read 2 more answers
When can primary succession occur? A. after a glacier forms, a volcano erupts, or when a strip mine is productive B. after a gla
Evgesh-ka [11]
B is the answer to your question. 
I hope this helped!
8 0
3 years ago
Other questions:
  • The allee effect
    8·1 answer
  • 1. What special structures are specific to the phylums of Porifera, Cnidaria, Ctenophora, and Platyhelminthes?
    9·1 answer
  • What list of articles would an ecological scientist most likely include when describing a forest community?
    10·1 answer
  • What is an inference?
    14·1 answer
  • The correct order of the movement food chain
    15·1 answer
  • Nitrogen -fixing bacteria take in nitrogen gas from the air and produce nitrogen compounds that living organisms can use. Which
    9·1 answer
  • In mice, black fur color is dominant over brown. But mice with two alleles for black fur color were albino. Which pattern of inh
    12·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • In the maternity ward, Mrs. Bright and Mrs. Light share a room. When they were ready
    10·1 answer
  • How many degrees north or south would you traverse if you went from the equator
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!