1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alenkinab [10]
3 years ago
7

SOMEONE PLEASEEEE HELP! this assesment is about thermal energy and chemical change for comprehensive science

Biology
1 answer:
Natasha2012 [34]3 years ago
3 0
Jjsjsksksksksksksjsjdjdkshdksgdkshshd
You might be interested in
A researcher determines an organism to be eukaryotic, unicellular, and autotrophic. In which taxonomic group should this organis
Aleksandr-060686 [28]

According to the characteristics of this organism, it is classified into the Protist kingdom, which brings together unicellular or simple multicellular organisms that do not form tissues, both autotrophic and heterotrophic.

<h3>What is the kingdom protista?</h3>

It includes eukaryote-type organisms that, due to their characteristics, cannot be included in the rest of the kingdoms of this class.

Although most protists are unicellular, there are also multicellular protists and they can have autotrophic or heterotrophic metabolisms.

Therefore, we can conclude that the protist kingdom groups living beings that have cells belonging to the eukaryote group.

Learn more about Protist kingdom here: brainly.com/question/26845151

5 0
3 years ago
All matter made of four elements
Mars2501 [29]

Answer:

The first theories of matter were put forward by Empedocles in 450 BC, he proposed that all matter was composed of four elements - Earth, air, fire and water. Later, Leucippus and Democritus suggested matter was made up of tiny indestructible particles continuously moving in empty space.

Explanation:

Got it from google hope this help :))

3 0
3 years ago
Read 2 more answers
Which of the following is a specialized cell that can recognize a hormone's chemical structure?
lbvjy [14]
Your answer would be Target cell. 
Hope this helps 
6 0
4 years ago
Read 2 more answers
What is the first branch of the right coronary artery?
ZanzabumX [31]
Right marginal artery
3 0
4 years ago
T A C G T G G A C T G A G G A C T C C T C is this a 'sense' strand or 'antisense' strand?
Leya [2.2K]

The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.

<h3>What is a sense DNA strand?</h3>

DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.

During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.

In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.

Learn more about transcription here:

brainly.com/question/1048150

8 0
3 years ago
Other questions:
  • Phospholipids, steroids and glycolipids are amphipathic and can form membranes made of lipid bilayers. On the other hand, trigly
    14·1 answer
  • Which of the following accurately describes nutrient limitation?
    12·1 answer
  • Eukaryotic cells have developed more specialized functions than prokaryotic cells. what is this referring to?
    6·2 answers
  • In science models are used for all of the following except
    8·1 answer
  • What describes the conversion of ADP to ATP?
    9·1 answer
  • 10.1 Limits To Cell Growth
    11·1 answer
  • I Learned that…
    9·2 answers
  • The term that describes vessels<br> closing in is
    14·1 answer
  • The risk of a laboratory acquired infection (LAI) can be reduced by all of the following EXCEPT?
    14·1 answer
  • When a molecule regulates the activity of an enzyme by binding to a site outside of the active site, it is known as a/an
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!