According to the characteristics of this organism, it is classified into the Protist kingdom, which brings together unicellular or simple multicellular organisms that do not form tissues, both autotrophic and heterotrophic.
<h3>What is the kingdom protista?</h3>
It includes eukaryote-type organisms that, due to their characteristics, cannot be included in the rest of the kingdoms of this class.
Although most protists are unicellular, there are also multicellular protists and they can have autotrophic or heterotrophic metabolisms.
Therefore, we can conclude that the protist kingdom groups living beings that have cells belonging to the eukaryote group.
Learn more about Protist kingdom here: brainly.com/question/26845151
Answer:
The first theories of matter were put forward by Empedocles in 450 BC, he proposed that all matter was composed of four elements - Earth, air, fire and water. Later, Leucippus and Democritus suggested matter was made up of tiny indestructible particles continuously moving in empty space.
Explanation:
Got it from google hope this help :))
Your answer would be Target cell.
Hope this helps
The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.
<h3>What is a sense DNA strand?</h3>
DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.
During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.
In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.
Learn more about transcription here:
brainly.com/question/1048150
