1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ser-zykov [4K]
3 years ago
9

If a cell loses water and shrinks it is known as a?

Biology
1 answer:
Ronch [10]3 years ago
5 0

Answer:

Hypertonic solutions

Explanation: hope this helps

You might be interested in
Name the 4 nucleotide bases and how they pair up.
S_A_V [24]

Answer:

Adenine Thymine

Cystenine Guanine

Explanation:

hope it helps

7 0
3 years ago
George on one pair of his chromosomes has STRs of lengths 6 and 7, Stephen (his father) STRs of lengths 3 and 6, and Mary (his m
JulijaS [17]

Answer:

Stephen is not his biological father.

Explanation:

DNA fingerprinting is a technique use to determine the DNA sequence of an individual organism. Short tandem repeats are unique among the individuals ans used to identify the individual in population.

The George DNA fingerprinting shows that he has STRs length of 6 and 7. Stephen's STRs does not match with his son George whereas Mary shows some similarities with George STRs. This indicates that Stephen is not the biological father of George because the biological father's STRs must match with the children STRs.

Thus, the correct answer is option (a).

4 0
4 years ago
​the production of sterile mules by interbreeding between female horses (mares) and male donkeys (jacks) is an example of
insens350 [35]

Answer:

reduced hybrid fertility

Explanation

The formation of mules  from the cross between female horses (mares) and male donkeys (jacks) is an example of reduced fertility because the mules are sterile and they cannot give birth to babies.

Reason:

Because mule cannot produce sperms. This has to do with his genetics. A mule has 63 chromosomes in total. He gets 32 chromosomes from his mom (that is a horse) and 31 chromosomes from his Dad (that is a donkey). As we know, it is very important for reproduction that chromosomes hould be present in two sets with equal numbers.

To reproduce he needs equal number of chromosomes because we know during meiosis chromosomes segregate and half number goes in daughter cells. But in case of mules he has an extra chromosome due to which he cannot undergo correct meiosis and produce sperms. That is ahy he stays sterile throughout his life. This is called reduced hybrid fertility

Hope it helps!

6 0
3 years ago
Many clinicians diagnose disorders by using criteria listed in the
katovenus [111]
Many clinicians diagnose disorders by using criteria listed in the DSM-5. The DSM-5 is the abbreviations for the diagnostic and statistical manual of mental disorders, it is the handbook used by the healthcare professionals as the guide to the diagnosis of mental disorders. It contains descriptions, symptoms, and other criteria for diagnosing mental disorders. 
7 0
4 years ago
I wanna know if this is correct?
Oliga [24]

Answer:

I believe your answer is correct

Explanation:

.

8 0
3 years ago
Read 2 more answers
Other questions:
  • What covers a cell, for biology.
    5·1 answer
  • Jellyfish, crayfish, and octopi all have a specialized cell in common. This cell helps the organism determine if it is right-sid
    7·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • 6. What is the benefit of a scientific name vs. a common<br> name?
    14·1 answer
  • ¿ Qué es el colágeno ? Definición corta
    6·1 answer
  • Hindus refer to the three most important parts of Brahman as:
    13·2 answers
  • Why is it important to know a person's rhesus Factor before a blood transfusion
    12·1 answer
  • a boy pushes a book by applying force of 5N.Find the work done by this force as the book is displaced through 20cm while pushing
    13·2 answers
  • What do we call the state in a human body if cerebreum is not functioning well?​
    5·1 answer
  • Did I do this correctly?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!