1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sati [7]
3 years ago
14

Many organisms that live in the rocky intertidal zone are adapted to cling to the rocks to withstand the a. pounding of the wave

s. b. changes in salinity. c. periods of being underwater and exposed to air. d. changes in density.
Biology
1 answer:
worty [1.4K]3 years ago
3 0
The correct option is POUNDING OF THE WAVES.
The intertidal zone in the marine aquatic environment refers to the regions of the foreshore and the seabed, which is exposed to the air at low tide and is submerged at high tide. The living organisms living in this zone are adapted to cling to the rocks in order to avoid been washed away by the waves.
You might be interested in
Which stage involves RNA polymerase
yawa3891 [41]
Termination? it would make sense if
4 0
2 years ago
What are two abiotic and two biotic conditions in a coral reef that provide the conditions necessary for it to have high biodive
Elena L [17]

Answer:

The two abiotic conditions in the coral reef that contribute to the high biodiversity are:

  1. Temperature
  2. Sunlight

Whilst the abiotic factors are

  1. Plant and
  2. Bacteria

Explanation:

The coral reef which covers a space of 115,831 square miles (or 30 million hectares os space) is home to a rich diversity of aquatic life (plants and animals alike). Being the largest coral reef on earth a lot of attention is given to it to ensure that its health and functionality is preserved.

The above factors contribute immensely to the stability and operability of the great reef.

The coral reef abounds with many aquatic animals such as crabs, herbivorous fish, sea turtles, sea urchins etc Many of these feed off microscopic plants such as the phytoplankton (that is tiny plants) and microscopic animals referred to as zooplankton. The zooplankton in turn feed off microscopic plant, bacterioplankton and even other zooplankton.

It is easy to see that at the base of the food chain lies Phytoplankton and bacterioplankton. This group require sunlight to thrive.

The smaller herbivorous fish, crabs, sea turtles and urchins on the other hand, constitute food for larger animals such as sharks, Baracuda etc.

It is also important to note that these microscopic life (plant and animals) require a certain temperature to thrive. If the water body in these eco system were to exceed a certain temperature, it is highly doubtful that they would survive. The death the the plant and animal life at the base of the food chain will completely disrupt the entire biodiversity and may even lead to its extinction.

Cheers!

7 0
3 years ago
Which genetic disorder causes the body to produce unusually thick mucus in the lungs and intestines?
galina1969 [7]

Answer: Cystic Fibrosis

Explanation:

Cystic fibrosis (abbreviated CF) is an autosomal recessive genetic disease that mainly affects the lungs, and to a lesser extent the pancreas, liver and intestine, causing an abnormally thick, sticky mucus to build up in these areas. This mucus collects in the airways of the lungs and pancreas.  The main cause of morbidity and mortality is pulmonary involvement, which accounts for 95% of deaths, mainly due to repeated infections caused by bronchial obstruction due to the secretion of very thick mucus.

This build up of mucus causes life-threatening lung infections and serious digestive problems.  It is one of the most common types of chronic lung disease in children and young adults, and is a life-threatening disorder; patients often die from lung infections due to <em>Pseudomonas</em> or <em>Staphylococcus</em>.

<u>It is a hereditary disease produced by a mutation in the gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR) protein. This protein is involved in the passage of chlorine ion through cell membranes and its deficiency alters the production of sweat, gastric juices and mucus. </u>The disease develops when neither allele is functional. Over 1500 mutations have been described for this disease, most of which are small deletions or point mutations; less than 1% are due to mutations in the promoter or chromosomal rearrangements. However, many people carry the CF gene, but do not have any symptoms. This is because a person with this disease must inherit 2 defective genes, 1 from each parent.

<u>There is no curative treatment, however there are treatments that allow the improvement of symptoms and extend life expectancy. In severe cases, the worsening of the disease may necessitate a lung transplant.</u>

3 0
3 years ago
What supplies blood to heart muscle​
shepuryov [24]

Answer:

The aorta.

Explanation:

The right coronary artery supplies blood mainly to the right side of the heart.

8 0
4 years ago
Read 2 more answers
If a microscope has an ocular with a 5x power and has objectives with powers of 10x and 50x what is the total magnification of l
expeople1 [14]
100,00 I do not know for real
8 0
4 years ago
Other questions:
  • Which of the following structures is responsible for providing energy for the cell
    11·2 answers
  • The average threshold for human hearing is the tick of a watch from ______ under very quiet conditions.
    15·1 answer
  • What happens if state laws conflict with the Constitution?
    13·2 answers
  • What type of mutation is likely to cause the most dramatic phenotypic change?
    7·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • 13. (02.05 LC)<br> What are the reactants for cellular respiration? (1 point)
    8·1 answer
  • How many Nitrogen Bases are found in DNA?
    7·1 answer
  • darwin found the bones of the ground sloth and what he thought was an anciet capybara in south america. he asked around, but nob
    9·1 answer
  • The plants in this ecosystem are dark in color to absorb sunlight, covered in hair and grow in clumps. What type of ecosystem co
    10·1 answer
  • 2. A car salesperson claims that a 300-hp engine is a necessary option in a compact car, in place of the conventioNl 130-hp engi
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!