1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vlada-n [284]
3 years ago
6

The minimal amount of nutrients needed every day by healthy people to prevent nutrient deficiencies is called the

Biology
1 answer:
adelina 88 [10]3 years ago
6 0
<span>The minimal amount of nutrients needed every day by healthy people to prevent nutrient deficiencies is called the RDA.
RDA stands for recommended dietary allowances. </span>RDA's are established by the Food and Nutrition Board of the National Academy of Sciences. There is a term RDI related to this. RDI stands for recommended daily intake.

You might be interested in
What is the sycamore tree​
Greeley [361]

Sycamore trees (Platanus occidentalis) make handsome shade trees for large landscapes.

Nice  \: pic

7 0
3 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
A brick is lifted above the ground and then dropped,
xeze [42]
The answer is C, gravitational potential to kinetic, but just a side note beware of posting questions that are that kind of evaluation. People can track you down for using any sort of site for help. So just keep in mind just send in the picture but not type in the entire question so that way you don’t get detected or have to retake the entire thing. Good luck btw
7 0
3 years ago
The active site of an enzyme is generally a a) Pocket/cleft b) Indentation c) Hole d) Tube e) Passageway
ANTONII [103]

a) pocket/cleft

Hope this helps!!!

5 0
3 years ago
Can someone please help me!!!!
valentinak56 [21]

Answer:

no 1 ok

Explanation:

because it controls the raye pf breathing so

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which explains how an endangered species and extinct species differ?
    10·1 answer
  • When the body is attacked by a foreign substance, the ____ defenses are the first to react.
    8·1 answer
  • Explain the energy flow in the ecosystem?
    14·1 answer
  • Which statements describe the pyrimidines in DNA?
    7·1 answer
  • Identify the correct sequence of the following events. a. Myosin generates a power stroke. b. Ca++ binds to troponin. c. ATP rec
    10·1 answer
  • 1. What process happens in the mitochondria?
    9·1 answer
  • Explain why the biomass of foxes is less than the biomass of rabbits
    11·2 answers
  • How many chromosomes does this cell have?
    6·2 answers
  • What is the function of chloroplast?
    12·2 answers
  • Lab: Exercise and Homeostasis Lab Report
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!