1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Wittaler [7]
3 years ago
13

What’s the difference between renewable and non renewable sources?

Biology
2 answers:
Anarel [89]3 years ago
5 0
Renewable sources are able to be used over and over again while non renewable sources may only be used once.

Hope this helps!
nadya68 [22]3 years ago
4 0
Renewable is more reliable and not a liability ther you go
You might be interested in
In Yosemite National park glaciers and volcanoes have helped create the landscape. Which of these were caused by glacier movemen
user100 [1]
Bedrock striations. Striations are marks or lines in the bedrock caused through glacial movement
3 0
3 years ago
Protists are
pickupchik [31]
<span>b. more like other protists than members of other kingdoms.</span>
3 0
3 years ago
Why is a ripple in a pond an example of mechanical waves?
ch4aika [34]
In transverse waves, the particle movement is perpendicular to the direction of wave propagation. Light and other types of electromagnetic radiation are examples of transverse waves. Some other examples of transverse waves include a ripple on a pond and a wave in a string.
5 0
3 years ago
Why therr is a need to budget the income of the family
Natalka [10]

Answer:

A household budget is all the more important in this consumer era because it teaches members of the family the worth of money. ... A household budget helps you to identify the areas in which you spend, and take necessary steps to curtail expenditure on those items that are non-essential and unnecessary.

Explanation:

Hope this <em><u>Helped!</u></em> :D

4 0
3 years ago
Read 2 more answers
Describe how the process of natural selection can cause an increase in how
Ksenya-84 [330]

Answer:

An individual may carry a very beneficial genotype with a resulting phenotype that, for example, increases the ability to reproduce

Explanation:

6 0
3 years ago
Other questions:
  • What organelle would be responsible for assembling cell proteins?
    13·1 answer
  • Describe any major landmarks (buildings, bridges, historical sites, etc.) that were destroyed during the earthquake.
    8·1 answer
  • Jen and jack are seated in the same row in an airplane but across the aisle from each other. if the information they exchange ac
    11·1 answer
  • Menstrual cramps are experienced with the onset of the menses because of strong contractions of the ____ layer of the uterus.​
    9·1 answer
  • If a native species has been labeled as endangered what is the appropriate response?
    9·2 answers
  • What has a coil of wire that rotates between two magnets and as the coil rotates an electric current is created?
    14·2 answers
  • Which observation about the phosphorus tracer supported the researchers' conclusion that DNA, and not proteins, transmits geneti
    12·1 answer
  • A teacher shows students a string of beads as a model of a chromosomes and genes. What do the beads represent? Explain
    6·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Compare the process of excretion in terrestrial arthropods with that in aquatic arthropods.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!