1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nimfa-mama [501]
3 years ago
7

Please answer this for me (8)

Biology
1 answer:
kogti [31]3 years ago
7 0

Answer:

A

Explanation:

You might be interested in
In the mid ____________ , ____________ was the first surgeon to introduce aseptic techniques into the operating room in an effor
svp [43]

alantic and Semmelweis was the first

5 0
2 years ago
The cells of a pea are all derived from a single cell formed by the fusion of two?
Arisa [49]

Answer:

The mitochondria

Explanation:

8 0
3 years ago
How is free water different from solute bound water (the key concept)?
Romashka [77]

Answer:

<h3><em>Water that can be extracted easily from foods by squeezing or cutting or pressing is known as free water, whereas water that cannot be extracted easily is termed as bound water.</em></h3>

<em></em>

4 0
3 years ago
How are prokaryotic and eukaryotic cells the same?
g100num [7]

Answer:

Like a prokaryotic cell, a eukaryotic cell has a plasma membrane, cytoplasm, and ribosomes

Explanation:

7 0
2 years ago
Read 2 more answers
In your own words, explain how fossil records of the past are reliable sources of information about evolution of life on Earth.
marta [7]
Fossils records the past by the very beginning of all living organism if there was wayer at one time by a fish fossil or if it was a dry land with a plant fossil 
4 0
3 years ago
Read 2 more answers
Other questions:
  • What best describes a tetrad
    5·1 answer
  • Which statement is true about climate change and biodiversity?
    8·1 answer
  • Which stores ground water
    15·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Give an example of how cells can be specialized
    15·1 answer
  • Contact lens solution is described as a sterile, buffered, isotonic aqueous solution. Explain the importance of the adjectives b
    9·1 answer
  • . One function of the circulatory system is to help maintain a uniform body temperature. Explain how the constant circulation of
    13·1 answer
  • WILL MARK BRAINLIEST IF CORRECT!!!!!!!!!!!!!
    8·1 answer
  • Currently behind in biology pls help
    10·1 answer
  • As greenhouse gas concentrations increase across the globe in our atmosphere, we are observing
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!