1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irakobra [83]
3 years ago
8

Why are natural bee populations inadequate at pollinating our crops

Biology
1 answer:
Colt1911 [192]3 years ago
6 0
Their biggest threats
The absence of an appropriate habitat for bees could lead to a continuous decline in pollination. Mono-cropping, pesticides, and higher temperatures associated with climate change all pose problems for bee populations and, by extension, the quality of food we grow.
You might be interested in
If someone adds millions of small fish to a lake, how would the number of big fish change
anyanavicka [17]
The big fish population will increase because they would have a lot of small fish to eat
6 0
3 years ago
Read 2 more answers
Biology help !!!! please help me with these i beg you.
Nezavi [6.7K]
It will be B as 37 degrees Celsius has the highest rate of reaction on the first graph and pH 6 has the highest rate of reaction in the second graph
6 0
3 years ago
Please help!
Nataliya [291]

Answer: Factors affecting biome type include latitude, humidity, and elevation. Terrestrial biomes include the tropical rainforest, chaparral, and taiga.

Explanation:

have a great day

4 0
3 years ago
how does the clearing and burning of large regions of tropical rain forest increase the amount of carbon dioxide in the atmosphe
Rainbow [258]
This increases by burning stuff, and also decreasing the amount of trees to change it.

8 0
3 years ago
Read 2 more answers
Comparison of Photosynthesis and Cellular Respiration
Zigmanuir [339]

Explanation:

Photosynthesis produces glucose and O2 from inorganic CO2, light energy and water.

6CO2 + 6H20 + (energy) → C6H12O6 + 6O2

These end products, namely O2 and glucose are then used in respiration...

C6H12O6 (glucose) + 6 O2 → 6 CO2 + 6 H2O + ≈38 ATP

The CO2 and H2O produced as waste in respiration can then be incorporated at the beginning of photosynthesis. Thus the reactions are cyclic- they feed into each other.

Further Explanation:

Photosynthesis is a chemical pathway that’s integral to producing energy in plants and other primary producers. Energy in the form of molecules of glucose is produced from light, water and carbon dioxide while oxygen is released. This occurs in several complex steps, photosynthesis is a rate limited reaction, depends on several factors including carbon dioxide concentration, ambient temperature and light intensity; the energy is retrieved from photons, I.e. particles of light, and water is used as a reducing agent. This occurs in the thykaloids, where pigment molecules like chlorophyll reside.

Occuring in several complex steps, photosynthesis is a rate limited reaction, depends on several factors including carbon dioxide concentration, ambient temperature and light intensity; the energy is retrieved from photons, I.e. particles of light, and water is used as a reducing agent. Water supplies the chlorophyll in plant cell with replacement electrons for the ones removed from photosystem II.

Additionally,

  • water (H2O) split by light during photolysis into H+ and OH- acts as a source of oxygen along with functioning as a reducing agent; it reduces the molecule NADP to NADPH by providing H+ ions and produces molecules of the energy storage molecule ATP through an electron transport chain.
  • This occurs in the thykaloids, where pigment molecules like chlorophyll reside.
  • Later, in dark reactions, NADP and NADPH are used in the Calvin cycle where monosaccharides or sugars like glucose are produced after the modification of several molecules. These store energy in their bonds, which can be released in respiration in the mitochondria.

In all eukaryotic cells mitochondria are small cellular organelles bound by membranes, these make most of the chemical energy required for powering the biochemical reactions within the cell. This chemical energy is stored within the molecule ATP which is produced.

Respiration in the mitochondria utilizes oxygen for the production of ATP in the Krebs’s cycle via the oxidization of pyruvate( through the process of glycoysis). The electron transport chain, in which oxygen functions as the terminal electron acceptor occurs in both plants and animals.

  • Glycolysis: occurs in the cytoplasm 2 molecules of ATP are used to cleave glucose into 2 pyruvates, 4 ATP and 2 electron carrying NADH molecules.
  • The Kreb's cycle: in the mitochondrial matrix- 6 molecules of CO2 are produced by combining oxygen and the carbon within pyruvate, 2 ATP oxygen molecules, 8 NADH and 2 FADH2.
  • The electron transport chain, ETC: in the inner mitochondrial membrane, 34 ATP, electrons combine with H+ split from 10 NADH, 4 FADH2, renewing the number of electron acceptors and 3 oxygen; this forms 6 H2O, 10 NAD+, 4 FAD.

Learn more about photosynthesis at brainly.com/question/4216541

Learn more about cellular respiration at brainly.com/question/11203046

Learn more about cellular life at brainly.com/question/11259903

#LearnWithBrainly

3 0
3 years ago
Other questions:
  • What animals can eat chocolate
    7·2 answers
  • Which of the following is a phase that results when the moon is on the same side of the earth as the sun?
    7·2 answers
  • The % DV (percent Daily Value) is based on an average 2,000-calorie diet. One gram of carbohydrate provides 4 calories of energy
    6·2 answers
  • Which is an example of matter cycling through the bodies of living things
    9·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • What molecules make up the sides of a DNA molecule?
    6·2 answers
  • I need help on acrostic writing?
    11·1 answer
  • Oil immersion is used because it increases: A. Resolution B. Contrast C. Refracted Light D. The working distance between the len
    6·1 answer
  • Does photosynthesis use all of the light that it collects
    5·1 answer
  • What is the difference between DNA replication and transcription process
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!