1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
TEA [102]
3 years ago
7

What are the three main groups of rocks and how are they formed

Biology
1 answer:
mariarad [96]3 years ago
6 0
The main three groups of rocks are metamorphic, sedimentary, and igneous. Igneous rocks are formed from melted lava and volcanic ashes. Metamorphic is a mixture of sedimentary and igneous and sedimentary are formed at or near the eat the surface by accumulation of sediment.
You might be interested in
Which of the following best describes the significance of the sequence of an individual’s DNA
aivan3 [116]

Answer:

Determining the order of DNA building blocks (nucleotides) in an individual's genetic code, called DNA sequencing, has advanced the study of genetics and is one technique used to test for genetic disorders. Two methods, whole exome sequencing and whole genome sequencing, are increasingly used in healthcare and research to identify genetic variations; both methods rely on new technologies that allow rapid sequencing of large amounts of DNA. These approaches are known as next-generation sequencing (or next-gen sequencing).

The original sequencing technology, called Sanger sequencing (named after the scientist who developed it, Frederick Sanger), was a breakthrough that helped scientists determine the human genetic code, but it is time-consuming and expensive. The Sanger method has been automated to make it faster and is still used in laboratories today to sequence short pieces of DNA, but it would take years to sequence all of a person's DNA (known as the person's genome). Next-generation sequencing has sped up the process (taking only days to weeks to sequence a human genome) while reducing the cost.

With next-generation sequencing, it is now feasible to sequence large amounts of DNA, for instance all the pieces of an individual's DNA that provide instructions for making proteins. These pieces, called exons, are thought to make up 1 percent of a person's genome. Together, all the exons in a genome are known as the exome, and the method of sequencing them is known as whole exome sequencing. This method allows variations in the protein-coding region of any gene to be identified, rather than in only a select few genes. Because most known mutations that cause disease occur in exons, whole exome sequencing is thought to be an efficient method to identify possible disease-causing mutations.

However, researchers have found that DNA variations outside the exons can affect gene activity and protein production and lead to genetic disorders--variations that whole exome sequencing would miss. Another method, called whole genome sequencing, determines the order of all the nucleotides in an individual's DNA and can determine variations in any part of the genome.

While many more genetic changes can be identified with whole exome and whole genome sequencing than with select gene sequencing, the significance of much of this information is unknown. Because not all genetic changes affect health, it is difficult to know whether identified variants are involved in the condition of interest. Sometimes, an identified variant is associated with a different genetic disorder that has not yet been diagnosed (these are called incidental or secondary findings).

In addition to being used in the clinic, whole exome and whole genome sequencing are valuable methods for researchers. Continued study of exome and genome sequences can help determine whether new genetic variations are associated with health conditions, which will aid disease diagnosis in the future.

Explanation:

6 0
2 years ago
Researchers have found that mitochondria and chloroplasts in eukaryotic cells have their own DNA. This DNA is different from the
ikadub [295]

Answer:

B. Early Eukaryotic cells engulfed mitochondria and chloroplasts

Explanation:

Mitochondria and Chloroplast are organelle that are found in cells of higher animals. Chloroplast are found almost exclusively in plants and mitochondria is found in animal cells. The function of these organelles are to produce energy to the cells, and by extension, the organism that they live in.  

Unique features of these organelles show that they have their own DNA and divide and multiply on their own. This strongly suggest that they were once free living prokaryotes and were engulfed by larger cells and a symbiotic relationship began.

As time progressed, these prokaryotes did not require all of their genetic information and this was removed from their system. They kept essential genes and regulatory bodies separate that they needed for their maintenance and function that they provide.  

8 0
3 years ago
Given the DNA sequence -- 5’ CTCTCCCCCGCGGGGGCTGTACTATCATGCGTCGTCTCGGUUAAUUU 3’ determine the mRNA sequence. (N.B. Answer must i
Marat540 [252]

During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.

In this case, the complementary mRNA sequence is:

  • 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´

  • Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.

  • Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.

  • According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.

  • In RNA, Thymine (T) bases are replaced by Uracil (U).

Learn more in:

brainly.com/question/837295?referrer=searchResults

7 0
2 years ago
Environmental factors typically activate genes in a cell by causing the cell to --
Drupady [299]

Environmental factors typically activate genes in a cell by causing the cell to transcribe specific DNA segments to mRNA for translation.

This interaction is an example of environmental factors affecting <u><em>genetic expression</em></u>. In these situations, the environment causes specific segments of DNA to be expressed, meaning they are transcribed to mRNA and subsequently used to form proteins.

Meanwhile, other parts of the genome remain or are forced to be silent. This can be a result of mutations or simple biochemical reactions between the environment and the genome.

To learn more visit:

brainly.com/question/8923584?referrer=searchResults

8 0
2 years ago
The Doppler effect indicates that the universe is expanding because_____
zimovet [89]
Your answer should be B
4 0
3 years ago
Read 2 more answers
Other questions:
  • Through which of the following processes is carbon removed from the atmosphere? decomposition of organic waste, burning of fossi
    10·2 answers
  • In the Henry experiments, current was produced in a coil by a
    7·1 answer
  • Spanish scientist observes that salmon produce more eggs when grown in a warmer aquariums he asked his colleagues in the United
    12·1 answer
  • In what process are carbon membranes being used instead of fine particle filtration? 1. air pollution sulfur particulate collect
    10·1 answer
  • Can someone help me with this
    8·1 answer
  • You are given a slide of a pathogen that is Gram-negative and whose subcellular structures can be observed with a light microsco
    10·1 answer
  • If Jack and Jill have a child with an Aaa genotype, during which meiotic division, and in which parent, could nondisjunction hav
    13·1 answer
  • Which of the organisms in the chart is a decomposer? Why are they<br> important?
    14·1 answer
  • GIVING BRAINLIEST, FIVE STARS AND THANKS!
    12·1 answer
  • The process by which ____________ become activated when the ____________ within the discs of the cells are altered by light ente
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!