1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Irina18 [472]
3 years ago
10

A flap of tissue that closes over the larynx during swallowing to prevent material from entering the lungs is called:

Biology
1 answer:
Andreas93 [3]3 years ago
5 0
Is called the epiglottis
You might be interested in
What is claymation?
maks197457 [2]

Answer:

B. Stop-motion animation created with clay and photographs.

(Ex...Tim Burton movies such as 'Coraline' or 'The Nightmare Before Christmas')

7 0
3 years ago
Read 2 more answers
Is an increase in size or body mass resulting from an increase in complete already formed body parts?
amid [387]
No, because if their already formed, how would they get bigger
5 0
3 years ago
What could be the consequence of a mutation that changes the sequence of nucleotides in a promoter?
Korolek [52]

Answer:

The changes in the sequence of nucleotides present within a promoter is a prime cause of the defected transcriptional regulation, which may eventually result in disease. However, not every modification within the sequence of a promoter influences the regulation of transcription, it relies upon the nature and the location of the genetic defect.  

When a mutation results within the sequence of a promoter region it may hamper the usual procedures of gene stimulation by affecting the step by step alignment of the transcription factors at the promoter region. Therefore, as a consequence, a mutation within the sequence of a promoter may result in the enhancement or reduction in the level of mRNA and thus protein.  

4 0
3 years ago
In the F2 generation of Mendel’s crosses
irina1246 [14]

In the f2 generation of mendel's crosses, all plants had the dominant trait,all plants had both the dominant and recessive alleles. one in four plants had two alleles for the recessive trait.

3 0
3 years ago
Unspecialized human cells are called ____________.
Blababa [14]

Answer:

stem cells

Explanation:

Stem cells differ from other kinds of cells in the body. All stem cells—regardless of their source—have three general properties: they are capable of dividing and renewing themselves for long periods; they are unspecialized; and they can give rise to specialized cell types.

4 0
3 years ago
Other questions:
  • Hormones that stimulate cell elongation and are produced in the rapidly growing region near the tip of the plant's root or stem
    5·1 answer
  • Which of these is the BEST example of the sustainable use of a natural resource? A) a treaty is reached to set a fixed price for
    6·1 answer
  • The haploid human genome contains about 3 × 109 nucleotides. On average, how many DNA fragments would be produced if this DNA wa
    15·1 answer
  • A change of the DNA in an organism that results in a new trait is known as a?
    15·1 answer
  • Photosynthesis and cellular respiration are considered complementary processes because
    13·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • This tutorial will take you step by step through the question. Individuals with the genotypes Aa Bb CC Dd and Aa bb Cc Dd are cr
    5·1 answer
  • Study the diagram of a cell.
    12·1 answer
  • Why can enzymes be used over and over again
    14·1 answer
  • According to biochemist sidney fox, once amino acids formed in the oceans, they may have collected in small pools to form small
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!