1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Soloha48 [4]
2 years ago
12

Which of the following is not true of neutron stars?

Biology
1 answer:
Sav [38]2 years ago
5 0

Answer:

You could lift a teaspoon of a neutron star.

Explanation:

A tablespoon of neutron star weighs more than 1 billion tons. So therefore u could not lift it.

You might be interested in
Complete the sentences by matching the names of trees to the appropriate blanks.
raketka [301]

Answer: A: Pine, Cedar and Mango.

B: Pine and Cedar

C: Mango, Cedar and Elm

D: Pine and Cedar

Explanation: Evergreens plants always have there leaves on regardless of the season, because their roots go very deep into the soil getting water and nutrients far below the levels other tap roots can go, they are mainly found in the rain forest region that have abundance of water. Example, Mango

Deciduous trees are usually found at desert places that dont always have water, so they lose their leaves during etreme weather to reduce the rate of evaporation of water on its surface. Example, Maple.

Hardwood: These are flowering plants. they usually have broad leaves and nuts. example, Mahogany.

Conifers: These are cone bearing seed plants. they are perennial and woody plants. Example Pine.

5 0
3 years ago
If the producers in this aquatic food chain produce 50,000kcal of energy; how much energy would the Perch have?
Snezhnost [94]

Answer:

The 10% Energy Rule in a Food Chain

4 0
3 years ago
Read 2 more answers
The nurse is caring for a client whose forehead feels warm to the touch. the nurse uses a thermometer and obtains the client's t
Ludmilka [50]
Confirming the clients core temperature...
3 0
3 years ago
Read 2 more answers
What is the amino acid sequence for AUGUCGCCUUAA?
Strike441 [17]

Answer:

Met-Ser-Pro.

Explanation:

The last 3 letters (UAA) are the Stop codons so they are not included in the sequence.

5 0
3 years ago
Read 2 more answers
Blank to indicate other students about the deteriorating environmental conditions in the steps needed to improve the area also e
tangare [24]

<u>Complete Question:</u>

Water pollution and air pollution in an area have been steadily increasing. What can students do to address these environmental hazards?

_______ to educate other students about the deteriorating environmental conditions and the steps needed to improve the area. Also, encourage other students to volunteer for workshops about _______.

1.

A. Pass Laws

B. Organize Seminars

C. Create a Tax collection program

2.

A. Recycling and waste disposal

B. Poaching

C. Deforestation

<u>Correct Option:</u>

<u>Organize seminars</u> to educate other students about the deteriorating environmental conditions and the steps needed to improve the area. Also, encourage other students to volunteer for workshops about <u>deforestation</u>.

<u>Option:</u> B and C respectively.

<u>Explanation:</u>

As the environmental conditions are deteriorating day by day, thus it is necessary to train to boost upcoming generation for preserving it in most appropriate manner. For such actions awareness is necessary which should be encouraged by some volunteers of non-profit organization, environment protecting units of state and central, etc to conduct seminar in colleges and schools for students to make them understand the need of plantation and disadvantages of deforestation. The pattern to aware them should be remarkable, in order to create huge impact on the new generations towards green land.  

5 0
3 years ago
Other questions:
  • during photosynthesis in Plants what is the source of carbon in the sugar molecule ( sorry know answer didn't know it was record
    14·2 answers
  • What is law of cross-cutting relationships
    9·1 answer
  • What is the basis on which the subdivisions in a Geological time scale are made
    6·1 answer
  • There is antibody-mediated and cell-mediated specific immunity. Which type of cells are primarily involved in the antibody-media
    12·1 answer
  • How do astronomers think the sun may have begun?
    11·1 answer
  • Glycolysis does not require oxygen<br> and is said to be?
    10·1 answer
  • The picture shows an organ system in the human body.
    8·1 answer
  • Each of the following traits is found in a bipedal hominin EXCEPT: Group of answer choices A c-shaped spine. A bowl shaped pelvi
    7·1 answer
  • What does nitrogen fixation accomplish?
    5·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!