1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergiy2304 [10]
3 years ago
7

10. If one strand of DNA is

Biology
1 answer:
soldi70 [24.7K]3 years ago
5 0

Answer:

Explanation:As previously stated, DNA is a macromolecule that's made up of individual subunits called nucleotides. Each nucleotide has three parts:

Brought to you by Sciencing

A deoxyribose sugar.

A phosphate group.

A nitrogenous base.

DNA nucleotides can contain one of four nitrogenous bases. These bases are adenine (A), thymine (T), guanine (G) and cytosine (C).

These nucleotides come together to form long chains known as DNA strands. Two complementary DNA strands bond to each other in what looks like a ladder before winding into the double helix form.

The two strands are held together through hydrogen bonds that form between the nitrogenous bases. Adenine (A) forms bonds with thymine (T) while cytosine (C) forms bonds with guanine (G); A only ever pairs with T, and C only ever pairs with G.

Complementary Definition (Biology)

In biology, specifically in terms of genetics and DNA, complementary means that the polynucleotide strand paired with the second polynucleotide strand has a nitrogenous base sequence that is the reverse complement, or the pair, of the other strand.

You might be interested in
In the family tree below, people with the recessive trait of attached earlobes
Law Incorporation [45]

Answer:  D) it is a female with two recessive alleles

Explanation:

Since the shape is a circle, we know it is a female. Since the shape is shaded, we know the posses the recessive trait, meaning they must have two of it's alleles.

5 0
3 years ago
Read 2 more answers
Ash trees are being removed when they show signs of the ash borer, a parasite that affects the trees and kills them off. What be
guajiro [1.7K]
<span>The ash trees are being cut when the show signs of infestation of the ash borer. Ash borer in particular the Emerald Ash Borer (EAB) is a tiny bug but can really do a great damage to the tree. When the tree is infested with the ash borer, they lay their eggs in the bark of tree, when the eggs hatch the lavas would start eating on the inner tissues of the tree blocking the flow of nutrients and water in the tree that causes the tree’s to death.  If the tree is infested they cut it down, burn and bury the wood to stop the spread of infestation. Ash trees are valued for its strength and elasticity that is often used to make baseball bats, bows, tool handles and other products that needs durable wood.</span>


7 0
3 years ago
Read 2 more answers
Two humans can have different traits because they
Nostrana [21]
Have different views or opinions
3 0
3 years ago
Read 2 more answers
The water hyacinth is an invasive species that can spread extremely fast, blanketing a water surface in a very short period of t
Veseljchak [2.6K]

1Answer:

The correct answer is - D. how changes in biodiversity impact an ecosystem.

Explanation:

The water hyacinth is an invasive plant species that rapidly grows and creates a thick layer over the water surface in almost every aquatic ecosystem. The growth of the layer of this species causes problems to the environment, ecosystem, humans, and other species.

These aquatic plants reduce the oxygen level and other nutrients from the ecosystem it is introduced and affect the biodiversity by increasing heavy metals and contaminants.

The layer of this plant inhibits photosynthesis that decreases sugar and energy production and blocks the boat and ship movements and economically as well.

3 0
3 years ago
Read 2 more answers
Polygenic means ______________ and _______________ is an example of a polygenic trait.
leva [86]
 Polygenic is a<span> </span>trait<span> that is controlled by a group of </span>nonallelic <span>genes. </span>For example, humans can be many different sizes. Height is a polygenic trait, controlled by at least three genes with six alleles. If you are dominant for all of the alleles for height, then you will be very tall. ... Skin color is also a polygenic trait, as are hair and eye color. A trait that is controlled by a group of nonallelic <span>genes

</span>
3 0
3 years ago
Other questions:
  • Which is more numerous,the amount of microbes or the amount of people
    5·2 answers
  • to study cells with a light microscope different types of stains are usually avaible why is it generally more useful to stain eu
    11·1 answer
  • What happens when the cloud becomes heavy?
    6·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What are the top 3 biological study’s
    9·1 answer
  • Match them correctly and ill give brainlyest
    9·1 answer
  • BRAINLYIST PLEASE HURRYYY
    11·1 answer
  • Please help me please help me ​
    7·1 answer
  • How are the same procesess of mitiosis and meosis simullar to each other?
    5·1 answer
  • Put the steps of DNA Replication in the correct order.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!