1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
expeople1 [14]
2 years ago
11

Low-quality energy has significant environmental implications because

Biology
1 answer:
AVprozaik [17]2 years ago
7 0
It contributes to weather patterns and causes ocean currents that regulate climate.
You might be interested in
How could stem cells prove helpful in the treatment of cardiovascular diseases? A) Stem cells can differentiate to form heart mu
Akimi4 [234]

Answer:

A

Explanation:

Cardiovascular diseases involves the heart.

Any of the above options with regards to blood (etc, white blood cells, red blood cells) are related to circulatory system, not affecting the function of the heart.

Stem cells performing apoptosis to remove old cells is a myth. Stem cells can only differentiate to form cells of the same lineage, not causing other cells to undergo apoptosis. The only external factor that can cause cells to undergo apoptosis is a type lymphocyte in the immune system

7 0
3 years ago
Which of the following can be considered fossils?
marysya [2.9K]
D.......................
3 0
3 years ago
In which biome do plants grow close to each other and close to the ground in order to resist the cold? deciduous forest desert t
N76 [4]

Answer:

D tundra

Explanation:

thank me later

3 0
2 years ago
Read 2 more answers
Using the drop-down menus, label the parts of an amino acid.
I am Lyosha [343]

Answer:

Label A is the amino group

Label B is the R group

Label C is the carboxyl group

Explanation:

3 0
2 years ago
Read 2 more answers
Which part of the Pakicetus anatomy most suggests that it is an ancestor of whales?
Burka [1]

Answer:

Pakicetus had an ear bone with a characteristic specific to whales and a distinctive long skull shape of a whale's.

Pakicetus

• Pakicetus was a wolf-sized animal and was a carnivore that at certain occasions consumed fish had exhibited features of its anatomy that associated it to the modern cetaceans, porpoises, whales, and dolphins.

• It had the body of a land animal, however, its head exhibited the distinctive long skull similar to a whale.

• With time, the fossils also showed that Pakicetus possessed an ear bone with a characteristic specific to whales.

Thus, pakicetus can be considered as the first whale who exhibited certain similar anatomic features like that of a whale.

Find out more information about Pakicetus anatomy here:

brainly.com/question/16395727

Explanation:

8 0
2 years ago
Other questions:
  • Describe how the availability of genetic sequencing can affect the frequency of genetic diseases in individuals and populations.
    6·2 answers
  • Before there were national nominating conventions, presidential nominees were selected by
    11·1 answer
  • Which minerals and vitamins usually are recommended to supplement a pregnant woman's diet?
    9·1 answer
  • As DNA is replicated, which DNA base pair will bond to cytosine?
    8·2 answers
  • Please Help
    7·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • The lymphatic system is closely associated with the
    11·1 answer
  • What are the common features of the favorite careers in your class?
    6·2 answers
  • How can we change the speed of a toy car on a racetrack to describe the car’s motion?
    12·2 answers
  • What is the role of knowing the Earth's history to mankind?​
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!