1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rom4ik [11]
4 years ago
10

Suppose a large number of dead fish are found floating in a lake. how would you determine whether they died from cultural eutrop

hication or from exposure to toxic chemicals?
Biology
1 answer:
Otrada [13]4 years ago
5 0
To determine the reason for the fish death, do the following:
1. Test the water for the presence of organic substances that may be poisonous to the fish.
2. Test the dissolved oxygen concentration of the lake at different locations and at different depths. 
3. Perform full toxicological examination of the lake to determine if any pollutant or poisonous chemical is present in the lake.<span />
You might be interested in
What has resulted in significant climate changes?
Novosadov [1.4K]

Answer:

In colder areas if it becomes warmer and hot which is the weather that area does not normally see then animals that live in this area may die or move locations fast because they are not made to live in hot places. Also nature, for example there are some plants and trees that are made to live in colder weather so when it becomes hot they will die and not grow in this area anymore becuase they cannot just get up and walk away as animals can.

Explanation:

3 0
3 years ago
The written notation used to represent the elements a compound contains and the relative number of atoms of each element is call
Anni [7]
Sorry I want points
7 0
3 years ago
How is the climate affecting this earth? Quick only 2 people can answer!!!!
bixtya [17]

Answer:

The climate is getting warmer so all the ice caps and other cold laces on earth with ice are melting therefore the sea levels are rising

Explanation:

SAVE THE TURTLES SKSKSKSKSK

6 0
4 years ago
Can a metric ruler find the volume of a solid?
Sidana [21]

Answer:

Cubic centimeters is the correct unit for measuring the volume of a solid. By contrast, liters are the correct units for measuring the volume of a liquid. For substances such as water, with a specific gravity of 1, each cubic centimeter of the liquid is equal to 1 milliliter of the liquid.

Explanation:water from the combined volume of the water and the solid. 6. The result is the volume of just the irregular shaped solid. The volume of just the water is 50 mL. After the small rock is placed in the cylinder the volume rises to 70mL. Subtract the 50 mL of water from the combined volume of 70 mL. The rock has a volume of 20 mL.

6 0
4 years ago
During sleep, the body provides fuel to the brain during sleep, the body provides fuel to the brain by breaking down body protei
dem82 [27]
The answer to this question would be: <span>by converting glucose to glycogen. 

Brain cells only able to use energy from glucose, so if the body glucose level is too low the brain cells can't work as it doesn't get any energy/food. When glucose level is decreased, the liver will start to convert glycogen into glucose to keep the glucose level.</span>
5 0
3 years ago
Other questions:
  • A callus is a hardening of skin, which protein is very abundant here?
    5·1 answer
  • Use the diagram below to answer the question.
    14·1 answer
  • Primary pathogen, opportunistic pathogen, and reservoirs are terms used to describe infections and infection cycles. Sort the de
    10·2 answers
  • Which of these is considered a renewable resource? A)gasoline B)oil C)Uranium D )water
    9·1 answer
  • Which one of its following abilities could have led to this?
    10·1 answer
  • Which species destroys 400 species of plants? (horse, Mediterranean fruit fly, Kudzu, Olive)
    15·2 answers
  • Some bacteria have chlorophyll in chloroplasts so they can conduct photosynthesis.
    13·1 answer
  • When an animal eats plant matter, which of the following components is the most resistant to the biting force of an animal's tee
    5·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Your class is using engineering principles to improve the design of football helmets to prevent brain injury. Your teacher divid
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!