1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nikdorinn [45]
3 years ago
5

In some deserts, there are mice and lizards that are about the same size. The mice eat grains, and the lizards feed on insects.

Given this information, we would expect that the biomass of the populations of
a. lizards would be about the same as the mice.
b. lizards would be greater than the mice.
c. mice would be greater than the lizards.
d. lizards and mice would be about 10 times greater than the organisms that they consume.
Biology
1 answer:
Scilla [17]3 years ago
8 0

Answer:

I think its B

Explanation:

I would expect more insects than grains in the desert...

You might be interested in
Describe the importance of the Hubble Telescope.<br> Enter your answer in the space provided.
Studentka2010 [4]

The Hubble Telescope is used for the observation of stars and galaxies that are far away from the universe and also for viewing the planets in our solar system.

<u>Explanation:</u>

It was 1990 when, the Hubble Space Telescope was launched. It mainly aims in the observation of the universe and the place from where the elements that make up the space has emerged. After the discovery in 1990, the observations made by this is about 1.3 million.

It is considered to one of the most important and a useful instrument that has been discovered. It only revolves around the earth and takes the images of stars,planets and other galaxies without reaching them. The mechanism of optics and detectors that more sensitive in nature are attached to this instrument.

4 0
3 years ago
What are parasites when cattle fights them off
9966 [12]
Dkdkdjjsjskdjdj hi
Jxjdjdjjdjxjx hi
Ndjdjjdjdjd idk
Dnndjdjd idk
5 0
3 years ago
If one parent is heterozygous white (Ww) and the other is homozygous black (ww), give the phenotype and genotype ratios for this
Leni [432]
A and C are the answers... There would be two Ww's and two ww's
3 0
3 years ago
Read 2 more answers
A words that ends in ing to describe the sun
Olenka [21]
burning (it’s a burning ball of gas)
6 0
3 years ago
Question 3
marysya [2.9K]

Answer:

"it was once part of the organisms from which the fossil fuels formed"

4 0
3 years ago
Other questions:
  • What is true of cells from a multicellular organism?
    13·1 answer
  • How does the warming of the world's ocean affect the water cycle?
    9·2 answers
  • What substances must pass through a cells membrane for the cell to continue to function?
    7·1 answer
  • Fungi and animals are both found in which eukaryotic supergroup?
    14·1 answer
  • This mammal retains its embryo in its uterus for the full term of the pregnancy. Which mammal is it most likely to be?
    13·1 answer
  • H2 + O2 → H2O
    10·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Darwin specifically studied the
    9·2 answers
  • Enlista los procesos involucrados en la nutricion y alimentacion,colorea con rojo los relacionados con la nutricion y con verde
    15·1 answer
  • GUYSSSSSSSSS ONLYYYYYYYYY HEHE LMA&gt;O
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!